pAAV-U6sgp53-mTSG-GFAPCre
(Plasmid
#100276)
-
PurposeAAV-CRISPR library for pool mutagenesis of top tumor suppressor genes
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | ||
---|---|---|---|---|---|---|
Plasmid | 100276 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $75 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonepAAV
-
Vector typeMammalian Expression, Mouse Targeting, AAV, CRISPR, Synthetic Biology
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Gene/Insert
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site SapI (destroyed during cloning)
- 3′ cloning site SapI (destroyed during cloning)
- 5′ sequencing primer aaagtggcaccgagtcggtgcTTTTTTtctagaagagggc
- 3′ sequencing primer cccagcacagagagggaggtgg (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
-
Terms and Licenses
-
Industry Terms
- Not Available to Industry
Depositor Comments
Please note that some sequence discrepancies were found between Addgene's quality control and the depositor's genbank sequence. The depositor noted that these discrepancies do NOT affect plasmid function.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pAAV-U6sgp53-mTSG-GFAPCre was a gift from Sidi Chen (Addgene plasmid # 100276 ; http://n2t.net/addgene:100276 ; RRID:Addgene_100276) -
For your References section:
AAV-mediated direct in vivo CRISPR screen identifies functional suppressors in glioblastoma. Chow RD, Guzman CD, Wang G, Schmidt F, Youngblood MW, Ye L, Errami Y, Dong MB, Martinez MA, Zhang S, Renauer P, Bilguvar K, Gunel M, Sharp PA, Zhang F, Platt RJ, Chen S. Nat Neurosci. 2017 Aug 14. doi: 10.1038/nn.4620. 10.1038/nn.4620