Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected] Learn more

(Plasmid #68544)


Item Catalog # Description Quantity Price (USD)
Plasmid 68544 Standard format: Plasmid sent in bacteria as agar stab 1 $65

This material is available to academics and nonprofits only.


  • Vector backbone
  • Backbone manufacturer
  • Backbone size w/o insert (bp) 4650
  • Vector type
    Mammalian Expression, AAV, Cre/Lox

Growth in Bacteria

  • Bacterial Resistance(s)
  • Growth Temperature
  • Growth Strain(s)
    NEB Stable
  • Copy number


  • Gene/Insert name
  • Alt name
    Cre recombinase
  • Promoter CMV
  • Tag / Fusion Protein
    • EGFP (N terminal on insert)

Cloning Information

  • Cloning method Unknown
  • 5′ sequencing primer pCAX-F CAGCTCCTGGGCAACGTGC
  • 3′ sequencing primer hGH-PA-R CCAGCTTGGTTCCCAATAGA
  • (Common Sequencing Primers)

Resource Information

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    AAV-Cre-GFP was a gift from Eric Nestler (Addgene plasmid # 68544 ; ; RRID:Addgene_68544)
  • For your References section:

    Class I HDAC inhibition blocks cocaine-induced plasticity by targeted changes in histone methylation. Kennedy PJ, Feng J, Robison AJ, Maze I, Badimon A, Mouzon E, Chaudhury D, Damez-Werno DM, Haggarty SJ, Han MH, Bassel-Duby R, Olson EN, Nestler EJ. Nat Neurosci. 2013 Apr;16(4):434-40. doi: 10.1038/nn.3354. Epub 2013 Mar 10. 10.1038/nn.3354 PubMed 23475113