Modified Shipping Schedule: Addgene will be closed November 23rd & 24th for the Thanksgiving holiday. Order processing and shipping may be delayed the week of Nov 20 - 24. If you have any questions, please contact us at [email protected].
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected] Learn more

AAV pmSyn1-EBFP-Cre
(Plasmid #51507)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 51507 Plasmid sent as bacteria in agar stab 1 $65
AAV1 51507-AAV1 Virus (100µL at titer ≥ 6×10¹² vg/mL)
and Plasmid. More Information
$380
AAV5 51507-AAV5 Virus (100µL at titer ≥ 7×10¹² vg/mL)
and Plasmid. More Information
$380
AAV Retrograde 51507-AAVrg Virus (100µL at titer ≥ 6×10¹² vg/mL)
and Plasmid. More Information
$380

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    pAAV-MCS
  • Backbone manufacturer
    Stratagene
  • Total vector size (bp) 6890
  • Modifications to backbone
    A fragment containing the pmSyn promoter-EBFP-Cre-bGHpA was swapped in to replace the CMV promoter-MCS-hGHpA sequence. Total insert size including the two ITRs is 4293 bp.
  • Vector type
    AAV

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    EBFP-Cre
  • Alt name
    Cre
  • Insert Size (bp)
    1761
  • Promoter pmSyn1

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site Not1 (not destroyed)
  • 3′ cloning site Not1 (not destroyed)
  • 5′ sequencing primer none
  • 3′ sequencing primer none
  • (Common Sequencing Primers)

Resource Information

Depositor Comments

This plasmid results in strong Cre expression levels, but little to no detectable EBFP.

Information for AAV1 (Catalog # 51507-AAV1) ( Back to top )

Purpose

Ready-to-use AAV1 particles produced from AAV pmSyn1-EBFP-Cre (#51507). In addition to the viral particles, you will also receive purified AAV pmSyn1-EBFP-Cre plasmid DNA.

EBFP-Cre expression under a human synapsin1 promoter. These AAV preparations are suitable purity for injection into animals.

Delivery

  • Volume 100 µL
  • Titer ≥ 6×10¹² vg/mL
  • Pricing $350 USD for preparation of 100 µL virus + $30 USD for plasmid.
  • Storage Store at -80℃. Thaw just before use and keep on ice.
  • Shipment Viral particles are shipped frozen on dry ice. Plasmid DNA (≥ 200ng) will also be included in the shipment.

Viral Production & Use

  • Packaging Plasmids encode adenoviral helper sequences and AAV rep gene
  • Envelope AAV1 cap gene
  • Buffer PBS + 0.001% Pluronic F-68 + 200 mM NaCl
  • Serotype AAV1
  • Purification Iodixanol gradient ultracentrifugation
  • Reporter Gene EBFP

Biosafety

Requestor is responsible for compliance with their institution's biosafety regulations. Lentivirus is generally considered BSL-2. AAV is generally considered BSL-1, but may require BSL-2 handling depending on the insert. Biosafety Guide

Viral Quality Control

Titering Method:
  • Real-time qPCR: The number of genome copies in viral preparations was measured by SYBR green real-time qPCR with primers targeting the ITR. Titer values were deduced by comparing the genomic content of the viral preparation to a standard curve of a plasmid of known concentration. Read our AAV Titration by qPCR protocol here.
Notes:
  • Purity of viral preparation: Viral preparations were subjected to polyacrylamide gel electrophoresis (PAGE) followed by silver staining and the molecular weight and relative intensity of the viral capsid proteins was analyzed. The abundance of viral capsid proteins as a fraction of total protein present in the sample was used to determine purity of the AAV preparation.
  • PCR confirmation of viral genome: PCR was carried out on the viral preparation with primers targeting the transgene. The PCR products were visualized on an agarose gel for size confirmation.
    • Transgene
      Promoter For: TTCTCACCACCAAGGGCAAG
      Cre Rev: CGCGCGCCTGAAGATATAGA

Visit our viral production page for more information.

Information for AAV5 (Catalog # 51507-AAV5) ( Back to top )

Purpose

Ready-to-use AAV5 particles produced from AAV pmSyn1-EBFP-Cre (#51507). In addition to the viral particles, you will also receive purified AAV pmSyn1-EBFP-Cre plasmid DNA.

EBFP-Cre expression under a human synapsin1 promoter. These AAV preparations are suitable purity for injection into animals.

Delivery

  • Volume 100 µL
  • Titer ≥ 7×10¹² vg/mL
  • Pricing $350 USD for preparation of 100 µL virus + $30 USD for plasmid.
  • Storage Store at -80℃. Thaw just before use and keep on ice.
  • Shipment Viral particles are shipped frozen on dry ice. Plasmid DNA (≥ 200ng) will also be included in the shipment.

Viral Production & Use

  • Packaging Plasmids encode adenoviral helper sequences and AAV rep gene
  • Envelope AAV5 cap gene
  • Buffer PBS + 0.001% Pluronic F-68 + 200 mM NaCl
  • Serotype AAV5
  • Purification Iodixanol gradient ultracentrifugation
  • Reporter Gene EBFP

Biosafety

Requestor is responsible for compliance with their institution's biosafety regulations. Lentivirus is generally considered BSL-2. AAV is generally considered BSL-1, but may require BSL-2 handling depending on the insert. Biosafety Guide

Viral Quality Control

Titering Method:
  • Real-time qPCR: The number of genome copies in viral preparations was measured by SYBR green real-time qPCR with primers targeting the ITR. Titer values were deduced by comparing the genomic content of the viral preparation to a standard curve of a plasmid of known concentration. Read our AAV Titration by qPCR protocol here.
Notes:
  • Purity of viral preparation: Viral preparations were subjected to polyacrylamide gel electrophoresis (PAGE) followed by silver staining and the molecular weight and relative intensity of the viral capsid proteins was analyzed. The abundance of viral capsid proteins as a fraction of total protein present in the sample was used to determine purity of the AAV preparation.
  • PCR confirmation of viral genome: PCR was carried out on the viral preparation with primers targeting the transgene. The PCR products were visualized on an agarose gel for size confirmation.
    • Transgene
      Promoter For: TTCTCACCACCAAGGGCAAG
      Cre Rev: CGCGCGCCTGAAGATATAGA

Visit our viral production page for more information.

Information for AAV Retrograde (Catalog # 51507-AAVrg) ( Back to top )

Purpose

Ready-to-use AAV Retrograde particles produced from AAV pmSyn1-EBFP-Cre (#51507). In addition to the viral particles, you will also receive purified AAV pmSyn1-EBFP-Cre plasmid DNA.

EBFP-Cre expression under a human synapsin1 promoter. These AAV were produced with a retrograde serotype, which permits retrograde access to projection neurons. These AAV preparations are suitable purity for injection into animals.

Delivery

  • Volume 100 µL
  • Titer ≥ 6×10¹² vg/mL
  • Pricing $350 USD for preparation of 100 µL virus + $30 USD for plasmid.
  • Storage Store at -80℃. Thaw just before use and keep on ice.
  • Shipment Viral particles are shipped frozen on dry ice. Plasmid DNA (≥ 200ng) will also be included in the shipment.

Viral Production & Use

  • Packaging Plasmids encode adenoviral helper sequences and AAV rep gene
  • Envelope AAV retrograde cap gene
    rAAV2-retro helper (plasmid #81070)
  • Buffer PBS + 0.001% Pluronic F-68 + 200 mM NaCl
  • Serotype AAVrg, encoded by rAAV2-retro helper (plasmid #81070)
  • Purification Iodixanol gradient ultracentrifugation
  • Reporter Gene EBFP

Biosafety

Requestor is responsible for compliance with their institution's biosafety regulations. Lentivirus is generally considered BSL-2. AAV is generally considered BSL-1, but may require BSL-2 handling depending on the insert. Biosafety Guide

Viral Quality Control

Titering Method:
  • Real-time qPCR: The number of genome copies in viral preparations was measured by SYBR green real-time qPCR with primers targeting the ITR. Titer values were deduced by comparing the genomic content of the viral preparation to a standard curve of a plasmid of known concentration. Read our AAV Titration by qPCR protocol here.
Notes:
  • Purity of viral preparation: Viral preparations were subjected to polyacrylamide gel electrophoresis (PAGE) followed by silver staining and the molecular weight and relative intensity of the viral capsid proteins was analyzed. The abundance of viral capsid proteins as a fraction of total protein present in the sample was used to determine purity of the AAV preparation.
  • PCR confirmation of viral genome: PCR was carried out on the viral preparation with primers targeting the transgene. The PCR products were visualized on an agarose gel for size confirmation.
    • Transgene
      Promoter For: TTCTCACCACCAAGGGCAAG
      Cre Rev: CGCGCGCCTGAAGATATAGA
  • Next-generation sequencing of viral genome: Next-generation sequencing was performed on viral genomes that were isolated from the final viral preparation. Sequencing results were analyzed to confirm the identity and integrity of the viral genome and the absence of unexpected DNA contaminants.
  • In-vivo expression: AAV pmSyn1-EBFP-Cre particles were injected into brain regions of a Rosa-LSL-H2B-GFP mouse, in which nuclear GFP expression is only activated by Cre. GFP expression was visualized two weeks later by direct fluorescence and indicates retrograde transport of EBFP-Cre from the injection site. You can view the in-vivo expression and details here or in the image section at the top of this page.

Visit our viral production page for more information.

Addgene Comments

Retrograde functionality is dependent on high viral titers. Addgene recommends not diluting your AAV preps prior to use.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    AAV pmSyn1-EBFP-Cre was a gift from Hongkui Zeng (Addgene plasmid # 51507)
  • For your References section:

    Transgenic mice for intersectional targeting of neural sensors and effectors with high specificity and performance. Madisen L, Garner AR, Shimaoka D, Chuong AS, Klapoetke NC, Li L, van der Bourg A, Niino Y, Egolf L, Monetti C, Gu H, Mills M, Cheng A, Tasic B, Nguyen TN, Sunkin SM, Benucci A, Nagy A, Miyawaki A, Helmchen F, Empson RM, Knopfel T, Boyden ES, Reid RC, Carandini M, Zeng H. Neuron. 2015 Mar 4;85(5):942-58. doi: 10.1016/j.neuron.2015.02.022. 10.1016/j.neuron.2015.02.022 PubMed 25741722