This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected] Learn more

AAV pCAG-FLEX-tdTomato-WPRE
(Plasmid #51503)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 51503 Plasmid sent as bacteria in agar stab 1 $65
AAV9 51503-AAV9 Virus (100 µL at titer ≥ 1×10¹³ vg/mL)
and Plasmid. More Information
$380
AAV Retrograde 51503-AAVrg Viral service discontinued. See similar plasmid 28306.
$380

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    pAAV-MCS
  • Backbone manufacturer
    Stratagene
  • Total vector size (bp) 7227
  • Modifications to backbone
    A fragment containing the pCAG promoter-FLEX-tdTomato-WPRE was swapped in to replace the CMV promoter-MCS-hGHpA sequence. Total insert size including the two ITRs is 5028 bp.
  • Vector type
    AAV

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    tdTomato
  • Insert Size (bp)
    1461
  • Promoter pCAG

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site Not1 (not destroyed)
  • 3′ cloning site Not1 (not destroyed)
  • 5′ sequencing primer none
  • 3′ sequencing primer none
  • (Common Sequencing Primers)

Resource Information

Depositor Comments

NOTE: The map generated by Addgene's software is inaccurate. ORF 3 is identified as dTomato, but the entire ORF 2 is actually a codon-optimized version of tdTomato.

Information for AAV9 (Catalog # 51503-AAV9) ( Back to top )

Purpose

Ready-to-use AAV9 particles produced from AAV pCAG-FLEX-tdTomato-WPRE (#51503). In addition to the viral particles, you will also receive purified AAV pCAG-FLEX-tdTomato-WPRE plasmid DNA.

Cre-dependent (FLEX) tdTomato expression. These AAV preparations are suitable purity for injection into animals.

Delivery

  • Volume 100 µL
  • Titer ≥ 1×10¹³ vg/mL
  • Pricing $350 USD for preparation of 100 µL virus + $30 USD for plasmid.
  • Storage Store at -80℃. Thaw just before use and keep on ice.
  • Shipment Viral particles are shipped frozen on dry ice. Plasmid DNA (≥ 200ng) will also be included in the shipment.

Viral Production & Use

  • Packaging Plasmids encode adenoviral helper sequences and AAV rep gene, AAV9 cap gene
  • Buffer PBS + 0.001% Pluronic F-68
  • Serotype AAV9
  • Purification Iodixanol gradient ultracentrifugation
  • Reporter Gene tdTomato

Biosafety

Requestor is responsible for compliance with their institution's biosafety regulations. Lentivirus is generally considered BSL-2. AAV is generally considered BSL-1, but may require BSL-2 handling depending on the insert. Biosafety Guide

Viral Quality Control

Titering Method:
  • Real-time qPCR or droplet digital PCR: The number of genome copies in viral preparations was measured by real-time qPCR or by droplet digital PCR. Titering on these preparations was performed by the University of Pennsylvania Vector Core. Read Addgene's AAV Titration by qPCR protocol here.
Notes:
  • Purity of viral preparation: Viral preparations were subjected to polyacrylamide gel electrophoresis (PAGE) followed by SYPRO Red staining and the molecular weight and relative intensity of the viral capsid proteins was analyzed. The abundance of viral capsid proteins as a fraction of total protein present in the sample was used to determine purity of the AAV preparation.

Visit our viral production page for more information.

Addgene Comments

Using FLEX vectors in vivo: LoxP sites in FLEX plasmids are known to recombine during DNA amplification and viral vector production, which may result in a minority of Cre-activated (i.e., "flipped") viral vectors. Addgene has measured this occurs in 0.01-0.03% of viral vectors in our typical production protocol. This can lead to a small number of cells exhibiting Cre-independent transgene expression in vivo. To address this, we recommend titrating to find the optimal AAV dosage required for Cre-dependent transgene expression and function in vivo. This may include reducing the viral vector dosage in order to reduce the likelihood of Cre-independent expression.

Information for AAV Retrograde (Catalog # 51503-AAVrg) ( Back to top )

Purpose

Ready-to-use AAV Retrograde particles produced from AAV pCAG-FLEX-tdTomato-WPRE (#51503). In addition to the viral particles, you will also receive purified AAV pCAG-FLEX-tdTomato-WPRE plasmid DNA.

Cre-dependent (FLEX) tdTomato expression. These AAV were produced with a retrograde serotype, which permits retrograde access to projection neurons. These AAV preparations are suitable purity for injection into animals.

Delivery

  • Volume .
  • Titer ≥ 5×10¹² vg/mL
  • Pricing $350 USD for preparation of . virus + $30 USD for plasmid.
  • Storage Store at -80℃. Thaw just before use and keep on ice.
  • Shipment Viral particles are shipped frozen on dry ice. Plasmid DNA (≥ 200ng) will also be included in the shipment.

Viral Production & Use

  • Packaging Plasmids encode adenoviral helper sequences and AAV rep gene
  • Envelope AAV retrograde cap gene
    rAAV2-retro helper (plasmid #81070)
  • Buffer PBS + 0.001% Pluronic F-68 + 200 mM NaCl
  • Serotype AAVrg, encoded by rAAV2-retro helper (plasmid #81070)
  • Purification Iodixanol gradient ultracentrifugation
  • Reporter Gene tdTomato

Biosafety

Requestor is responsible for compliance with their institution's biosafety regulations. Lentivirus is generally considered BSL-2. AAV is generally considered BSL-1, but may require BSL-2 handling depending on the insert. Biosafety Guide

Resource Information

Viral Quality Control

Titering Method:
  • Real-time qPCR: The number of genome copies in viral preparations was measured by SYBR green real-time qPCR with primers targeting the ITR. Titer values were deduced by comparing the genomic content of the viral preparation to a standard curve of a plasmid of known concentration. Read our AAV Titration by qPCR protocol here.
Notes:
  • Purity of viral preparation: Viral preparations were subjected to polyacrylamide gel electrophoresis (PAGE) followed by silver staining and the molecular weight and relative intensity of the viral capsid proteins was analyzed. The abundance of viral capsid proteins as a fraction of total protein present in the sample was used to determine purity of the AAV preparation.
  • PCR confirmation of viral genome: PCR was carried out on the viral preparation with primers that only produce amplicons in the FLEX orientation. The PCR products were visualized on an agarose gel for size confirmation.
    • Transgene
      tdTomato For: GCCACTACCTGGTGGAGTTC
      WPRE Rev: GCAGAATCCAGGTGGCAACA
    • FLEX orientation
      tdTomato For: GCCACTACCTGGTGGAGTTC
      WPRE For: CCTTTCCGGGACTTTCGCTTT

Visit our viral production page for more information.

Addgene Comments

Retrograde functionality is dependent on high viral titers. Addgene recommends not diluting your AAV preps prior to use.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    AAV pCAG-FLEX-tdTomato-WPRE was a gift from Hongkui Zeng (Addgene plasmid # 51503)

    For viral preps, please replace (Addgene plasmid # 51503) in the above sentence with: (Addgene viral prep # 51503-AAV9) or (Addgene viral prep # 51503-AAVrg)

  • For your References section:

    A mesoscale connectome of the mouse brain. Oh SW, Harris JA, Ng L, Winslow B, Cain N, Mihalas S, Wang Q, Lau C, Kuan L, Henry AM, Mortrud MT, Ouellette B, Nguyen TN, Sorensen SA, Slaughterbeck CR, Wakeman W, Li Y, Feng D, Ho A, Nicholas E, Hirokawa KE, Bohn P, Joines KM, Peng H, Hawrylycz MJ, Phillips JW, Hohmann JG, Wohnoutka P, Gerfen CR, Koch C, Bernard A, Dang C, Jones AR, Zeng H. Nature. 2014 Apr 10;508(7495):207-14. doi: 10.1038/nature13186. Epub 2014 Apr 2. 10.1038/nature13186 PubMed 24695228