Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

pEF1a-BirA-V5-neo
(Plasmid #100548)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 100548 Standard format: Plasmid sent in bacteria as agar stab 1 $85

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    pEF1a-V5-neo
  • Backbone size w/o insert (bp) 6174
  • Total vector size (bp) 7088
  • Vector type
    Mammalian Expression
  • Selectable markers
    Neomycin (select with G418)

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    C-terminal V5-tagged BirA
  • Species
    E. coli
  • Insert Size (bp)
    963
  • Promoter Human EF1a
  • Tag / Fusion Protein
    • V5, His (C terminal on insert)

Cloning Information

  • Cloning method Gibson Cloning
  • 5′ sequencing primer TAATACGACTCACTATAGGG
  • 3′ sequencing primer TAGAAGGCACAGTCGAGG
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pEF1a-BirA-V5-neo was a gift from Jian Xu (Addgene plasmid # 100548 ; http://n2t.net/addgene:100548 ; RRID:Addgene_100548)
  • For your References section:

    In Situ Capture of Chromatin Interactions by Biotinylated dCas9. Liu X, Zhang Y, Chen Y, Li M, Zhou F, Li K, Cao H, Ni M, Liu Y, Gu Z, Dickerson KE, Xie S, Hon GC, Xuan Z, Zhang MQ, Shao Z, Xu J. Cell. 2017 Aug 24;170(5):1028-1043.e19. doi: 10.1016/j.cell.2017.08.003. 10.1016/j.cell.2017.08.003 PubMed 28841410