pEF1a-BirA-V5-neo
(Plasmid #100548)

• Purpose: Expresses C-terminal V5-tagged BirA biotin ligase
• Depositing Lab: Jian Xu
• Publication: Liu et al Cell. 2017 Aug 24;170(5):1028-1043.e19. doi: 10.1016/j.cell.2017.08.003.

Ordering

Item	Catalog #	Description	Quantity	Price (USD)
Plasmid	100548	Standard format: Plasmid sent in bacteria as agar stab	1	$75	Add to Cart

This material is available to academics and nonprofits only.

Backbone

• Vector backbone: pEF1a-V5-neo
  (Search Vector Database)
• Backbone size w/o insert (bp): 6174
• Total vector size (bp): 7088
• Vector type: Mammalian Expression
• Selectable markers: Neomycin (select with G418)

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: Unknown

Gene/Insert

• Gene/Insert name: C-terminal V5-tagged BirA
• Species: E. coli
• Insert Size (bp): 963
• Promoter: Human EF1a
• Tag / Fusion Protein:
  • V5, His (C terminal on insert)

Cloning Information

• Cloning method: Gibson Cloning
• 5′ sequencing primer: TAATACGACTCACTATAGGG
• 3′ sequencing primer: TAGAAGGCACAGTCGAGG

Resource Information

• Supplemental Documents:
  • pEF1a-BirA-V5-neo.gb
• Addgene Notes:
  • Addgene Diagnostic Digest
• Terms and Licenses:
  • UBMTA
• Industry Terms:
  • Not Available to Industry
• Article Citing this Plasmid:
  • 1 Reference