-
PurposeExpresses N-terminal Flag and biotin-acceptor-site (FB)-tagged dCas9 protein
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 100547 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonepEF1a-FB-puro
- Backbone size w/o insert (bp) 7064
- Total vector size (bp) 11244
-
Vector typeMammalian Expression, CRISPR
-
Selectable markersPuromycin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberUnknown
Gene/Insert 1
-
Gene/Insert nameN-terminal Flag and biotin-acceptor-site (FB)-tagged dCas9
-
SpeciesStreptococcus pyogenes
-
Insert Size (bp)4305
- Promoter Human EF1a
-
Tag
/ Fusion Protein
- FLAG, Biotin-acceptor-site (Avitag) (N terminal on insert)
Cloning Information for Gene/Insert 1
- Cloning method Gibson Cloning
- 5′ sequencing primer CTTCCATTTCAGGTGTCGTG
- 3′ sequencing primer ctggccacctctgcttgt (Common Sequencing Primers)
Gene/Insert 2
-
Gene/Insert namepuromycin
-
SpeciesStreptomyces alboniger
-
Insert Size (bp)600
Resource Information
-
Supplemental Documents
-
Articles Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pEF1a-FB-dCas9-puro was a gift from Jian Xu (Addgene plasmid # 100547 ; http://n2t.net/addgene:100547 ; RRID:Addgene_100547) -
For your References section:
In Situ Capture of Chromatin Interactions by Biotinylated dCas9. Liu X, Zhang Y, Chen Y, Li M, Zhou F, Li K, Cao H, Ni M, Liu Y, Gu Z, Dickerson KE, Xie S, Hon GC, Xuan Z, Zhang MQ, Shao Z, Xu J. Cell. 2017 Aug 24;170(5):1028-1043.e19. doi: 10.1016/j.cell.2017.08.003. 10.1016/j.cell.2017.08.003 PubMed 28841410