Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

pDRF’- AmTryoshka1;3-GS
(Plasmid #100967)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 100967 Standard format: Plasmid sent in bacteria as agar stab 1 $85

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    pDRf1
  • Backbone size w/o insert (bp) 6939
  • Total vector size (bp) 9869
  • Vector type
    Yeast Expression
  • Selectable markers
    URA3

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    AmTryoshka1;3-GS
  • Alt name
    AmTryoshka-GS-FN_non functional
  • Species
    A. thaliana (mustard weed)
  • Insert Size (bp)
    2935
  • Entrez Gene
    AMT1;3 (a.k.a. AT3G24300, AMMONIUM TRANSPORTER 1;3, ATAMT1;3, ammonium transporter 1;3)
  • Promoter PMA

Cloning Information

  • Cloning method Gateway Cloning
  • 5′ sequencing primer AACAATCGTTAATAATTAATTAATTGG
  • 3′ sequencing primer GAAGTGTCAACAACGTATCTACC
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pDRF’- AmTryoshka1;3-GS was a gift from Wolf Frommer (Addgene plasmid # 100967 ; http://n2t.net/addgene:100967 ; RRID:Addgene_100967)
  • For your References section:

    Ratiometric Matryoshka biosensors from a nested cassette of green- and orange-emitting fluorescent proteins. Ast C, Foret J, Oltrogge LM, De Michele R, Kleist TJ, Ho CH, Frommer WB. Nat Commun. 2017 Sep 5;8(1):431. doi: 10.1038/s41467-017-00400-2. 10.1038/s41467-017-00400-2 [pii] PubMed 28874729