Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected] Learn more

pAAV hSyn1 ChR2 ET-TC 2A tDimer
(Plasmid #101361)


Item Catalog # Description Quantity Price (USD)
Plasmid 101361 Standard format: Plasmid sent in bacteria as agar stab 1 $75

This material is available to academics and nonprofits only.


  • Vector backbone
  • Backbone manufacturer
  • Backbone size w/o insert (bp) 4606
  • Total vector size (bp) 7012
  • Vector type
    Mammalian Expression, AAV

Growth in Bacteria

  • Bacterial Resistance(s)
  • Growth Temperature
  • Growth Strain(s)
    NEB Stable
  • Copy number
    High Copy

Gene/Insert 1

  • Gene/Insert name
  • Alt name
    ChR2 E123T-T159C
  • Species
  • Insert Size (bp)
  • Mutation
    E123T , T159C
  • Promoter human Synapsin

Cloning Information for Gene/Insert 1

  • Cloning method Restriction Enzyme
  • 5′ cloning site NheI (not destroyed)
  • 3′ cloning site KpnI (not destroyed)
  • 5′ sequencing primer gactcagcgctgcctcagtctg
  • 3′ sequencing primer GCGGTGA CGTGGAGGA GAATC
  • (Common Sequencing Primers)

Gene/Insert 2

  • Gene/Insert name
    synaptophysin-red fluorescent protein
  • Alt name
  • Species
    Discosoma sp.
  • Insert Size (bp)
  • Promoter human Synapsin

Cloning Information for Gene/Insert 2

  • Cloning method Restriction Enzyme
  • 5′ cloning site BamHI (not destroyed)
  • 3′ cloning site HindIII (not destroyed)
  • 5′ sequencing primer ggcagaggaagtcttctaacat
  • 3′ sequencing primer cgataatcaacctctggattac
  • (Common Sequencing Primers)

Resource Information

Depositor Comments

ChR originally from P.Hegemann, HU-Berlin Germany
tDimer originally from R-Tsien USD USA

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pAAV hSyn1 ChR2 ET-TC 2A tDimer was a gift from Thomas Oertner (Addgene plasmid # 101361 ; ; RRID:Addgene_101361)
  • For your References section:

    High-efficiency channelrhodopsins for fast neuronal stimulation at low light levels. Berndt A, Schoenenberger P, Mattis J, Tye KM, Deisseroth K, Hegemann P, Oertner TG. Proc Natl Acad Sci U S A. 2011 May 3;108(18):7595-600. doi: 10.1073/pnas.1017210108. Epub 2011 Apr 19. 10.1073/pnas.1017210108 PubMed 21504945