This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected] Learn more

(Plasmid #51085)


Item Catalog # Description Quantity Price (USD)
Plasmid 51085 Plasmid sent as bacteria in agar stab 1 $65
AAV1 51085-AAV1 Virus (100 µL at titer ≥ 7×10¹² vg/mL)
and Plasmid. More Information
AAV Retrograde 51085-AAVrg Virus (100µL at titer ≥ 7×10¹² vg/mL)
and Plasmid. More Information

This material is available to academics and nonprofits only.


  • Vector backbone
  • Backbone manufacturer
    Modified from Karl Deisseroth
  • Backbone size w/o insert (bp) 4590
  • Total vector size (bp) 6750
  • Modifications to backbone
    Altered cloning sites
  • Vector type
    Mammalian Expression, AAV

Growth in Bacteria

  • Bacterial Resistance(s)
  • Growth Temperature
  • Growth Strain(s)
  • Copy number
    High Copy


  • Gene/Insert name
  • Alt name
  • Alt name
    GCaMP6 fast
  • Species
  • Insert Size (bp)
  • Promoter human Synapsin1
  • Tag / Fusion Protein
    • P2A-nls-dTomato (C terminal on insert)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site BamHI (not destroyed)
  • 3′ cloning site AscI (not destroyed)
  • 5′ sequencing primer ctcagcgctgcctcagtctg
  • 3′ sequencing primer CCATACGGGAAGCAATAGCATG
  • (Common Sequencing Primers)

Resource Information

Depositor Comments

The addition of the P2A-nls-dTomato allows for easy identification of GCaMP6 expressing cells exhibiting nuclear red fluorescence that does not significantly overlap with the cytosolic GCaMP signal. The GCaMP and fluorophore are physically uncoupled.

Permissions were obtained from Douglas Kim and the Clontech licensing office for depositing this new plasmid.

Information for AAV1 (Catalog # 51085-AAV1) ( Back to top )


Ready-to-use AAV1 particles produced from AAV-hSyn1-GCaMP6f-P2A-nls-dTomato (#51085). In addition to the viral particles, you will also receive purified AAV-hSyn1-GCaMP6f-P2A-nls-dTomato plasmid DNA.

GCaMP6f calcium sensor and bicistronic, physically separate nuclear localized dTomato expression under the Synapsin promoter. These AAV preparations are suitable purity for injection into animals.


  • Volume 100 µL
  • Titer ≥ 7×10¹² vg/mL
  • Pricing $350 USD for preparation of 100 µL virus + $30 USD for plasmid.
  • Storage Store at -80℃. Thaw just before use and keep on ice.
  • Shipment Viral particles are shipped frozen on dry ice. Plasmid DNA (≥ 200ng) will also be included in the shipment.

Viral Production & Use

  • Packaging Plasmids encode adenoviral helper sequences and AAV rep gene
  • Envelope AAV1 cap gene
  • Buffer PBS + 0.001% Pluronic F-68 + 200 mM NaCl
  • Serotype AAV1
  • Purification Iodixanol gradient ultracentrifugation
  • Reporter Gene nuclear dTomato (physically separate, not a fusion protein)


Requestor is responsible for compliance with their institution's biosafety regulations. Lentivirus is generally considered BSL-2. AAV is generally considered BSL-1, but may require BSL-2 handling depending on the insert. Biosafety Guide

Viral Quality Control

Titering Method:
  • Real-time qPCR: The number of genome copies in viral preparations was measured by SYBR green real-time qPCR with primers targeting the ITR. Titer values were deduced by comparing the genomic content of the viral preparation to a standard curve of a plasmid of known concentration. Read our AAV Titration by qPCR protocol here.
  • Purity of viral preparation: Viral preparations were subjected to polyacrylamide gel electrophoresis (PAGE) followed by silver staining and the molecular weight and relative intensity of the viral capsid proteins was analyzed. The abundance of viral capsid proteins as a fraction of total protein present in the sample was used to determine purity of the AAV preparation.
  • Confirmation of protein expression: AAVPro cells were transduced with 51085-AAV1. Five days later, dTomato expression (red) was visualized by direct fluorescence.
  • PCR confirmation of viral genome: PCR was carried out on the viral preparation with primers targeting the transgene. The PCR products were visualized on an agarose gel for size confirmation.
    • Transgene

Visit our viral production page for more information.

Information for AAV Retrograde (Catalog # 51085-AAVrg) ( Back to top )


Ready-to-use AAV Retrograde particles produced from AAV-hSyn1-GCaMP6f-P2A-nls-dTomato (#51085). In addition to the viral particles, you will also receive purified AAV-hSyn1-GCaMP6f-P2A-nls-dTomato plasmid DNA.

GCaMP6f calcium sensor and bicistronic, physically separate nuclear localized dTomato expression under a human synapsin1 promoter. These AAV were produced with a retrograde serotype, which permits retrograde access to projection neurons. These AAV preparations are suitable purity for injection into animals.


  • Volume 100 µL
  • Titer ≥ 7×10¹² vg/mL
  • Pricing $350 USD for preparation of 100 µL virus + $30 USD for plasmid.
  • Storage Store at -80℃. Thaw just before use and keep on ice.
  • Shipment Viral particles are shipped frozen on dry ice. Plasmid DNA (≥ 200ng) will also be included in the shipment.

Viral Production & Use

  • Packaging Plasmids encode adenoviral helper sequences and AAV rep gene
  • Envelope AAV retrograde cap gene
    rAAV2-retro helper (plasmid #81070)
  • Buffer PBS + 0.001% Pluronic F-68
  • Serotype AAVrg, encoded by rAAV2-retro helper (plasmid #81070)
  • Purification Iodixanol gradient ultracentrifugation
  • Reporter Gene nuclear dTomato (physically separate, not a fusion protein)


Requestor is responsible for compliance with their institution's biosafety regulations. Lentivirus is generally considered BSL-2. AAV is generally considered BSL-1, but may require BSL-2 handling depending on the insert. Biosafety Guide

Resource Information

Viral Quality Control

Titering Method:
  • Real-time qPCR: The number of genome copies in viral preparations was measured by SYBR green real-time qPCR with primers targeting the ITR. Titer values were deduced by comparing the genomic content of the viral preparation to a standard curve of a plasmid of known concentration. Read our AAV Titration by qPCR protocol here.
  • Purity of viral preparation: Viral preparations were subjected to polyacrylamide gel electrophoresis (PAGE) followed by silver staining and the molecular weight and relative intensity of the viral capsid proteins was analyzed. The abundance of viral capsid proteins as a fraction of total protein present in the sample was used to determine purity of the AAV preparation.
  • PCR confirmation of viral genome: PCR was carried out on the viral preparation with primers targeting the transgene. The PCR products were visualized on an agarose gel for size confirmation.
    • Transgene
  • Next-generation sequencing of viral genome: Next-generation sequencing was performed on viral genomes that were isolated from the final viral preparation. Sequencing results were analyzed to confirm the identity and integrity of the viral genome and the absence of unexpected DNA contaminants.
  • In-vivo expression: Retrograde hSyn1-GCaMP6f-P2A-nls-dTomato particles were injected into brain regions of a C57BL/6 mouse. GCaMP and dTomato expression was visualized two weeks later by direct fluorescence and exhibit retrograde transport from the injection site. You can view the in-vivo expression and details here or in the image section at the top of this page.

Visit our viral production page for more information.

Addgene Comments

Retrograde functionality is dependent on high viral titers. Addgene recommends not diluting your AAV preps prior to use.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    AAV-hSyn1-GCaMP6f-P2A-nls-dTomato was a gift from Jonathan Ting (Addgene plasmid # 51085)