-
PurposeForebrain principle neuron specific expression of GCaMP6s Ca sensor and physically separate nuclear localized dTomato fluorophore
-
Depositing Lab
-
Publication
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | ||
---|---|---|---|---|---|---|
Plasmid | 51086 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $75 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonepAAV-CaMKIIa-WPRE-BGHpA
-
Backbone manufacturercustom
- Backbone size w/o insert (bp) 5095
- Total vector size (bp) 7255
-
Modifications to backboneAltered cloning sites and replaced HGHpA with smaller BGHpA
-
Vector typeMammalian Expression, AAV
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin
-
Growth Temperature37°C
-
Growth Strain(s)Stbl3
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameGCaMP6s
-
Alt nameG6s
-
Alt nameGCaMP6 slow
-
SpeciesSynthetic
-
Insert Size (bp)2160
- Promoter CaMKIIa 1.3 kb
-
Tag
/ Fusion Protein
- P2A-nls-dTomato (C terminal on insert)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site BamHI (not destroyed)
- 3′ cloning site AscI (not destroyed)
- 5′ sequencing primer ttctccgtttgcactcaggagc
- 3′ sequencing primer CCATACGGGAAGCAATAGCATG (Common Sequencing Primers)
Resource Information
-
A portion of this plasmid was derived from a plasmid made byThe GCaMP6s portion was derived from Addgene plasmid #40753 (Douglas Kim, Janelia Farms).
-
Terms and Licenses
-
Industry Terms
- Not Available to Industry
Depositor Comments
The addition of the P2A-nls-dTomato allows for easy identification of GCaMP6 expressing cells exhibiting nuclear red fluorescence that does not significantly overlap with the cytosolic GCaMP signal. The GCaMP and fluorophore are physically uncoupled.
Permissions were obtained from Douglas Kim and the Clontech licensing office for depositing this new plasmid.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
AAV-CaMKIIa-GCaMP6s-P2A-nls-dTomato was a gift from Jonathan Ting (Addgene plasmid # 51086 ; http://n2t.net/addgene:51086 ; RRID:Addgene_51086)