-
PurposeCre dependent expression of GCaMP6s Ca sensor and physically separate nuclear localized dTomato fluorophore
-
Depositing Lab
-
Publication
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | ||
---|---|---|---|---|---|---|
Plasmid | 51082 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $75 | ||
AAV1 | 51082-AAV1 | Virus (100 µL at titer ≥ 5×10¹² vg/mL) and Plasmid. |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonepAAV-EF1a-DIO-WPRE-BGHpA
-
Backbone manufacturercustom
- Backbone size w/o insert (bp) 5320
- Total vector size (bp) 7484
-
Modifications to backboneAltered cloning sites and replaced HGHpA with smaller BGHpA
-
Vector typeMammalian Expression, AAV
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin
-
Growth Temperature37°C
-
Growth Strain(s)Stbl3
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameGCaMP6s
-
Alt nameG6s
-
Alt nameGCaMP6 slow
-
SpeciesSynthetic
- Promoter hEF1a
-
Tag
/ Fusion Protein
- P2A-nls-dTomato (C terminal on insert)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site AscI (not destroyed)
- 3′ cloning site SfoI (destroyed during cloning)
- 5′ sequencing primer gccagcttggcacttgatgtaattctcc
- 3′ sequencing primer CCATACGGGAAGCAATAGCATG (Common Sequencing Primers)
Resource Information
-
A portion of this plasmid was derived from a plasmid made byThe GCaMP6s portion was derived from Addgene plasmid #40753 (Douglas Kim, Janelia Farms).
-
Terms and Licenses
-
Industry Terms
- Not Available to Industry
-
Articles Citing this Plasmid
Depositor Comments
The addition of the P2A-nls-dTomato allows for easy identification of GCaMP6 expressing cells exhibiting nuclear red fluorescence that does not significantly overlap with the cytosolic GCaMP signal. The GCaMP and fluorophore are physically uncoupled.
Permissions were obtained from Douglas Kim and the Clontech licensing office for depositing this new plasmid.
Information for AAV1 (Catalog # 51082-AAV1) ( Back to top )
Purpose
Ready-to-use AAV1 particles produced from AAV-EF1a-DIO-GCaMP6s-P2A-nls-dTomato (#51082). In addition to the viral particles, you will also receive purified AAV-EF1a-DIO-GCaMP6s-P2A-nls-dTomato plasmid DNA.
GCaMP6s calcium sensor and bicistronic, physically separate nuclear localized dTomato expression under the EF1a promoter. These AAV preparations are suitable purity for injection into animals.Delivery
- Volume 100 µL
- Titer ≥ 5×10¹² vg/mL
- Pricing $350 USD for preparation of 100 µL virus + $30 USD for plasmid.
- Storage Store at -80℃. Thaw just before use and keep on ice.
- Shipment Viral particles are shipped frozen on dry ice. Plasmid DNA (≥ 200ng) will also be included in the shipment.
Viral Production & Use
- Packaging Plasmids encode adenoviral helper sequences and AAV rep gene, AAV1 cap gene
- Buffer PBS + 0.001% Pluronic F-68 + 200 mM NaCl
- Serotype AAV1
- Purification Iodixanol gradient ultracentrifugation
- Reporter Gene nuclear dTomato (physically separate, not a fusion protein)
Biosafety
Requestor is responsible for compliance with their institution's biosafety regulations. Lentivirus is generally considered BSL-2. AAV is generally considered BSL-1, but may require BSL-2 handling depending on the insert. Biosafety Guide
Resource Information
-
Terms and Licenses
-
Industry Terms
- Not Available to Industry
Viral Quality Control
- Addgene ensures high quality viral vectors by optimizing and standardizing production protocols and performing rigorous quality control (QC) (see a list of our QC assays). The specific QC assays performed varies for each viral lot. To learn which specific QC assays were performed on your lot, please contact us.
- Titer: the exact titer of your sample will be reported on the tube. The titer you see listed on this page is the guaranteed minimum titer. See how titers are measured.
Visit our viral production page for more information.
Addgene Comments
Using FLEX vectors in vivo: LoxP sites in FLEX plasmids are known to recombine during DNA amplification and viral vector production, which may result in a minority of Cre-activated (i.e., "flipped") viral vectors. Addgene has measured this occurs in 0.1-0.6% of viral vectors in our typical production protocol. This can lead to a small number of cells exhibiting Cre-independent transgene expression in vivo. To address this, we recommend titrating to find the optimal AAV dosage required for Cre-dependent transgene expression and function in vivo. This may include reducing the viral vector dosage in order to reduce the likelihood of Cre-independent expression.
Data submitted about 51082-AAV1 by requesting scientist(s):
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
AAV-EF1a-DIO-GCaMP6s-P2A-nls-dTomato was a gift from Jonathan Ting (Addgene plasmid # 51082 ; http://n2t.net/addgene:51082 ; RRID:Addgene_51082)
For viral preps, please replace (Addgene plasmid # 51082) in the above sentence with: (Addgene viral prep # 51082-AAV1)