This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected] Learn more

(Plasmid #50474)


Item Catalog # Description Quantity Price (USD)
Plasmid 50474 Plasmid sent as bacteria in agar stab 1 $65
AAV2 50474-AAV2 Virus (100 µL at titer ≥ 3×10¹² vg/mL)
and Plasmid. More Information
AAV5 50474-AAV5 Virus (100 µL at titer ≥ 3×10¹² vg/mL)
and Plasmid. More Information
AAV8 50474-AAV8 Virus (100 µL at titer ≥ 2×10¹² vg/mL)
and Plasmid. More Information
AAV Retrograde 50474-AAVrg Virus (100 µL at titer ≥ 7×10¹² vg/mL)
and Plasmid. More Information

This material is available to academics and nonprofits only.


  • Vector backbone
  • Backbone size w/o insert (bp) 4818
  • Total vector size (bp) 7070
  • Vector type

Growth in Bacteria

  • Bacterial Resistance(s)
  • Growth Temperature
  • Growth Strain(s)
    NEB Stable
  • Copy number
    Low Copy


  • Gene/Insert name
  • Species
    H. sapiens (human)
  • Insert Size (bp)
  • Mutation
    See supplemental documents for DREADD mutations
  • Entrez Gene
    CHRM3 (a.k.a. EGBRS, HM3, PBS)
  • Promoter human Synapsin 1
  • Tag / Fusion Protein
    • mCherry (C terminal on insert)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site Sal I (not destroyed)
  • 3′ cloning site EcoR I (not destroyed)
  • 5′ sequencing primer TCGTGTCGTGCCTGAGAGCG
  • (Common Sequencing Primers)

Resource Information

Depositor Comments

Please Note- This plasmid does NOT contain an N-terminal HA tag.

For more information on DREADDs, see:

Information for AAV2 (Catalog # 50474-AAV2) ( Back to top )


Ready-to-use AAV2 particles produced from pAAV-hSyn-hM3D(Gq)-mCherry (#50474). In addition to the viral particles, you will also receive purified pAAV-hSyn-hM3D(Gq)-mCherry plasmid DNA.

CNO-induced neuronal burst firing. Synapsin-driven with mCherry reporter. These AAV preparations are suitable purity for injection into animals.


  • Volume 100 µL
  • Titer ≥ 3×10¹² vg/mL
  • Pricing $350 USD for preparation of 100 µL virus + $30 USD for plasmid.
  • Storage Store at -80℃. Thaw just before use and keep on ice.
  • Shipment Viral particles are shipped frozen on dry ice. Plasmid DNA (≥ 200ng) will also be included in the shipment.

Viral Production & Use

  • Packaging Plasmids encode adenoviral helper sequences and AAV rep gene
  • Envelope AAV2 cap gene
  • Buffer PBS + 0.001% Pluronic F-68
  • Serotype AAV2
  • Purification CsCl gradient ultracentrifugation
  • Reporter Gene mCherry


Requestor is responsible for compliance with their institution's biosafety regulations. Lentivirus is generally considered BSL-2. AAV is generally considered BSL-1, but may require BSL-2 handling depending on the insert. Biosafety Guide

Resource Information

Viral Quality Control

Titering Method:
  • Real-time qPCR: The number of genome copies in viral preparations was measured by SYBR green real-time qPCR with primers targeting the ITR. Titer values were deduced by comparing the genomic content of the viral preparation to a standard curve of a plasmid of known concentration. Read our AAV Titration by qPCR protocol here.
  • Purity of viral preparation: Viral preparations were subjected to polyacrylamide gel electrophoresis (PAGE) followed by silver staining and the molecular weight and relative intensity of the viral capsid proteins was analyzed. The abundance of viral capsid proteins as a fraction of total protein present in the sample was used to determine purity of the AAV preparation.
  • PCR confirmation of viral genome: PCR was carried out on the viral preparation with primers that only produce amplicons in the non-DIO orientation. PCR was also carried out on the viral preparation with primers targeting the transgene. The PCR products were visualized on an agarose gel for size confirmation.
    • Transgene
    • DIO orientation
    • Non-DIO orientation
  • Next-generation sequencing of viral genome: Next-generation sequencing was performed on viral genomes that were isolated from the final viral preparation. Sequencing results were analyzed to confirm the identity and integrity of the viral genome and the absence of unexpected DNA contaminants.

Visit our viral production page for more information.

Information for AAV5 (Catalog # 50474-AAV5) ( Back to top )


Ready-to-use AAV5 particles produced from pAAV-hSyn-hM3D(Gq)-mCherry (#50474). In addition to the viral particles, you will also receive purified pAAV-hSyn-hM3D(Gq)-mCherry plasmid DNA.

CNO-induced neuronal burst firing. Synapsin-driven with mCherry reporter. These AAV preparations are suitable purity for injection into animals.


  • Volume 100 µL
  • Titer ≥ 3×10¹² vg/mL
  • Pricing $350 USD for preparation of 100 µL virus + $30 USD for plasmid.
  • Storage Store at -80℃. Thaw just before use and keep on ice.
  • Shipment Viral particles are shipped frozen on dry ice. Plasmid DNA (≥ 200ng) will also be included in the shipment.

Viral Production & Use

  • Packaging Plasmids encode adenoviral helper sequences and AAV rep gene
  • Envelope AAV5 cap gene
  • Buffer PBS + 0.001% Pluronic F-68
  • Serotype AAV5
  • Purification Iodixanol gradient ultracentrifugation
  • Reporter Gene mCherry


Requestor is responsible for compliance with their institution's biosafety regulations. Lentivirus is generally considered BSL-2. AAV is generally considered BSL-1, but may require BSL-2 handling depending on the insert. Biosafety Guide

Resource Information

Viral Quality Control

Titering Method:
  • Real-time qPCR: The number of genome copies in viral preparations was measured by SYBR green real-time qPCR with primers targeting the ITR. Titer values were deduced by comparing the genomic content of the viral preparation to a standard curve of a plasmid of known concentration. Read our AAV Titration by qPCR protocol here.
  • Purity of viral preparation: Viral preparations were subjected to polyacrylamide gel electrophoresis (PAGE) followed by silver staining and the molecular weight and relative intensity of the viral capsid proteins was analyzed. The abundance of viral capsid proteins as a fraction of total protein present in the sample was used to determine purity of the AAV preparation.
  • PCR confirmation of viral genome: PCR was carried out on the viral preparation with primers that only produce amplicons in the non-DIO orientation. PCR was also carried out on the viral preparation with primers targeting the transgene. The PCR products were visualized on an agarose gel for size confirmation.
    • Transgene
    • DIO orientation
    • Non-DIO orientation

Visit our viral production page for more information.

Information for AAV8 (Catalog # 50474-AAV8) ( Back to top )


Ready-to-use AAV8 particles produced from pAAV-hSyn-hM3D(Gq)-mCherry (#50474). In addition to the viral particles, you will also receive purified pAAV-hSyn-hM3D(Gq)-mCherry plasmid DNA.

CNO-induced neuronal burst firing. Synapsin-driven with mCherry reporter. These AAV preparations are suitable purity for injection into animals.


  • Volume 100 µL
  • Titer ≥ 2×10¹² vg/mL
  • Pricing $350 USD for preparation of 100 µL virus + $30 USD for plasmid.
  • Storage Store at -80℃. Thaw just before use and keep on ice.
  • Shipment Viral particles are shipped frozen on dry ice. Plasmid DNA (≥ 200ng) will also be included in the shipment.

Viral Production & Use

  • Packaging Plasmids encode adenoviral helper sequences and AAV rep gene
  • Envelope AAV8 cap gene
  • Buffer PBS + 0.001% Pluronic F-68
  • Serotype AAV8
  • Purification Iodixanol gradient ultracentrifugation
  • Reporter Gene mCherry


Requestor is responsible for compliance with their institution's biosafety regulations. Lentivirus is generally considered BSL-2. AAV is generally considered BSL-1, but may require BSL-2 handling depending on the insert. Biosafety Guide

Viral Quality Control

Titering Method:
  • Real-time qPCR: The number of genome copies in viral preparations was measured by SYBR green real-time qPCR with primers targeting the ITR. Titer values were deduced by comparing the genomic content of the viral preparation to a standard curve of a plasmid of known concentration. Read our AAV Titration by qPCR protocol here.
  • Purity of viral preparation: Viral preparations were subjected to polyacrylamide gel electrophoresis (PAGE) followed by silver staining and the molecular weight and relative intensity of the viral capsid proteins was analyzed. The abundance of viral capsid proteins as a fraction of total protein present in the sample was used to determine purity of the AAV preparation.
  • PCR confirmation of viral genome: PCR was carried out on the viral preparation with primers that only produce amplicons in the non-DIO orientation. PCR was also carried out on the viral preparation with primers targeting the transgene. The PCR products were visualized on an agarose gel for size confirmation.
    • Transgene
    • DIO orientation
    • Non-DIO orientation
  • Next-generation sequencing of viral genome: Next-generation sequencing was performed on viral genomes that were isolated from the final viral preparation. Sequencing results were analyzed to confirm the identity and integrity of the viral genome and the absence of unexpected DNA contaminants.

Visit our viral production page for more information.

Information for AAV Retrograde (Catalog # 50474-AAVrg) ( Back to top )


Ready-to-use AAV Retrograde particles produced from pAAV-hSyn-hM3D(Gq)-mCherry (#50474). In addition to the viral particles, you will also receive purified pAAV-hSyn-hM3D(Gq)-mCherry plasmid DNA.

CNO-induced neuronal burst firing. Synapsin-driven with mCherry reporter. These AAV were produced with a retrograde serotype, which permits retrograde access to projection neurons. These AAV preparations are suitable purity for injection into animals.


  • Volume 100 µL
  • Titer ≥ 7×10¹² vg/mL
  • Pricing $350 USD for preparation of 100 µL virus + $30 USD for plasmid.
  • Storage Store at -80℃. Thaw just before use and keep on ice.
  • Shipment Viral particles are shipped frozen on dry ice. Plasmid DNA (≥ 200ng) will also be included in the shipment.

Viral Production & Use

  • Packaging Plasmids encode adenoviral helper sequences and AAV rep gene
  • Envelope AAV retrograde cap gene
    rAAV2-retro helper (plasmid #81070)
  • Buffer PBS + 0.001% Pluronic F-68 + 200 mM NaCl
  • Serotype AAVrg rAAV2-retro helper (plasmid #81070)
  • Purification Iodixanol gradient ultracentrifugation
  • Reporter Gene mCherry


Requestor is responsible for compliance with their institution's biosafety regulations. Lentivirus is generally considered BSL-2. AAV is generally considered BSL-1, but may require BSL-2 handling depending on the insert. Biosafety Guide

Resource Information

Viral Quality Control

Titering Method:
  • Real-time qPCR: The number of genome copies in viral preparations was measured by SYBR green real-time qPCR with primers targeting the ITR. Titer values were deduced by comparing the genomic content of the viral preparation to a standard curve of a plasmid of known concentration. Read our AAV Titration by qPCR protocol here.
  • Purity of viral preparation: Viral preparations were subjected to polyacrylamide gel electrophoresis (PAGE) followed by silver staining and the molecular weight and relative intensity of the viral capsid proteins was analyzed. The abundance of viral capsid proteins as a fraction of total protein present in the sample was used to determine purity of the AAV preparation.
  • Confirmation of protein expression and retrograde function: This virus was tested in vivo for retrograde function and protein expression.
  • PCR confirmation of viral genome: PCR was carried out on the viral preparation with primers that only produce amplicons in the non-DIO orientation. PCR was also carried out on the viral preparation with primers targeting the transgene. The PCR products were visualized on an agarose gel for size confirmation.
    • Transgene
    • DIO orientation
    • Non-DIO orientation
  • Next-generation sequencing of viral genome: Next-generation sequencing was performed on viral genomes that were isolated from the final viral preparation. Sequencing results were analyzed to confirm the identity and integrity of the viral genome and the absence of unexpected DNA contaminants.

Visit our viral production page for more information.

Addgene Comments

Retrograde functionality is dependent on high viral titers. Addgene recommends not diluting your AAV preps prior to use.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pAAV-hSyn-hM3D(Gq)-mCherry was a gift from Bryan Roth (Addgene plasmid # 50474)

    For viral preps, please replace (Addgene plasmid # 50474) in the above sentence with: (Addgene viral prep # 50474-AAV2), (Addgene viral prep # 50474-AAV5), (Addgene viral prep # 50474-AAV8), or (Addgene viral prep # 50474-AAVrg)