Modified Shipping Schedule: Addgene will be closed November 23rd & 24th for the Thanksgiving holiday. Order processing and shipping may be delayed the week of Nov 20 - 24. If you have any questions, please contact us at [email protected].
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected] Learn more

pAAV-CaMKIIa-hM3D(Gq)-mCherry
(Plasmid #50476)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 50476 Plasmid sent as bacteria in agar stab 1 $65
AAV5 50476-AAV5 Virus (100 µL at titer ≥ 2×10¹² vg/mL)
and Plasmid. More Information
$380
AAV8 50476-AAV8 Virus (100 µL at titer ≥ 3×10¹² vg/mL)
and Plasmid. More Information
$380

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    pAAV
  • Backbone size w/o insert (bp) 4818
  • Total vector size (bp) 7886
  • Vector type
    AAV

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    Low Copy

Gene/Insert

  • Gene/Insert name
    hM3D(Gq)-mCherry
  • Species
    H. sapiens (human)
  • Insert Size (bp)
    2502
  • Mutation
    See supplemental documents for DREADD mutations
  • Entrez Gene
    CHRM3 (a.k.a. EGBRS, HM3, PBS)
  • Promoter CaMKIIa
  • Tag / Fusion Protein
    • mCherry (C terminal on insert)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site Sal I (not destroyed)
  • 3′ cloning site EcoR I (not destroyed)
  • 5′ sequencing primer ATGCTGACGAAGGCTCGCGA
  • 3′ sequencing primer GCATTAAAGCAGCGTATCCACATAGC
  • (Common Sequencing Primers)

Resource Information

Depositor Comments

Information for AAV5 (Catalog # 50476-AAV5) ( Back to top )

Purpose

Ready-to-use AAV5 particles produced from pAAV-CaMKIIa-hM3D(Gq)-mCherry (#50476). In addition to the viral particles, you will also receive purified pAAV-CaMKIIa-hM3D(Gq)-mCherry plasmid DNA.

CNO-induced neuronal burst firing. CaMKIIa-driven with mCherry reporter. These AAV preparations are suitable purity for injection into animals.

Delivery

  • Volume 100 µL
  • Titer ≥ 2×10¹² vg/mL
  • Pricing $350 USD for preparation of 100 µL virus + $30 USD for plasmid.
  • Storage Store at -80℃. Thaw just before use and keep on ice.
  • Shipment Viral particles are shipped frozen on dry ice. Plasmid DNA (≥ 200ng) will also be included in the shipment.

Viral Production & Use

  • Packaging Plasmids encode adenoviral helper sequences and AAV rep gene
  • Envelope AAV5 cap gene
  • Buffer PBS + 0.001% Pluronic F-68
  • Serotype AAV5
  • Purification CsCl gradient ultracentrifugation
  • Reporter Gene mCherry

Biosafety

Requestor is responsible for compliance with their institution's biosafety regulations. Lentivirus is generally considered BSL-2. AAV is generally considered BSL-1, but may require BSL-2 handling depending on the insert. Biosafety Guide

Viral Quality Control

Titering Method:
  • Real-time qPCR: The number of genome copies in viral preparations was measured by SYBR green real-time qPCR with primers targeting the ITR. Titer values were deduced by comparing the genomic content of the viral preparation to a standard curve of a plasmid of known concentration. Read our AAV Titration by qPCR protocol here.
Notes:
  • Purity of viral preparation: Viral preparations were subjected to polyacrylamide gel electrophoresis (PAGE) followed by silver staining and the molecular weight and relative intensity of the viral capsid proteins was analyzed. The abundance of viral capsid proteins as a fraction of total protein present in the sample was used to determine purity of the AAV preparation.
  • PCR confirmation of viral genome: PCR was carried out on the viral preparation with primers that only produce amplicons with the correct insert and orientation. The PCR products were visualized on an agarose gel for size confirmation.
    • Transgene
      hM3D For: GCCTGTGCCGATCTGATTAT
      hM3D Rev: CTTGAGCACGATGGAGTAGATG
    • Transgene (no product expected)
      hM4D For: TCACGTCATCATCCCACAATC
      hM4D Rev: CTGTCTGCTTCGTCACAATCT
    • Orientation
      CaMKII For: GACAGGAGCCCCAGGAGACCAA
      hM3D Rev: CTTGAGCACGATGGAGTAGATG
    • Orientation
      CaMKII For: GACAGGAGCCCCAGGAGACCAA
      Cherry Rev: CTTGTACAGCTCGTCCATGCCG
  • In-vivo expression: Expression data were kindly shared by scientists using Addgene's AAV in their labs. You can view the in-vivo expression and details here or in the image section at the top of this page.

Visit our viral production page for more information.

Information for AAV8 (Catalog # 50476-AAV8) ( Back to top )

Purpose

Ready-to-use AAV8 particles produced from pAAV-CaMKIIa-hM3D(Gq)-mCherry (#50476). In addition to the viral particles, you will also receive purified pAAV-CaMKIIa-hM3D(Gq)-mCherry plasmid DNA.

CNO-induced neuronal burst firing. CaMKIIa-driven with mCherry reporter.

Delivery

  • Volume 100 µL
  • Titer ≥ 3×10¹² vg/mL
  • Pricing $350 USD for preparation of 100 µL virus + $30 USD for plasmid.
  • Storage Store at -80℃. Thaw just before use and keep on ice.
  • Shipment Viral particles are shipped frozen on dry ice. Plasmid DNA (≥ 200ng) will also be included in the shipment.

Viral Production & Use

  • Packaging Plasmids encode adenoviral helper sequences and AAV rep gene
  • Envelope AAV8 cap gene
  • Buffer PBS + 0.001% Pluronic F-68
  • Serotype AAV8
  • Purification Iodixanol gradient ultracentrifugation
  • Reporter Gene mCherry

Biosafety

Requestor is responsible for compliance with their institution's biosafety regulations. Lentivirus is generally considered BSL-2. AAV is generally considered BSL-1, but may require BSL-2 handling depending on the insert. Biosafety Guide

Viral Quality Control

Titering Method:
  • Real-time qPCR: The number of genome copies in viral preparations was measured by SYBR green real-time qPCR with primers targeting the ITR. Titer values were deduced by comparing the genomic content of the viral preparation to a standard curve of a plasmid of known concentration. Read our AAV Titration by qPCR protocol here.
Notes:
  • Purity of viral preparation: Viral preparations were subjected to polyacrylamide gel electrophoresis (PAGE) followed by silver staining and the molecular weight and relative intensity of the viral capsid proteins was analyzed. The abundance of viral capsid proteins as a fraction of total protein present in the sample was used to determine purity of the AAV preparation.
  • PCR confirmation of viral genome: PCR was carried out on the viral preparation with primers that only produce amplicons with the correct insert and orientation. The PCR products were visualized on an agarose gel for size confirmation.
    • Transgene
      hM3D For: GCCTGTGCCGATCTGATTAT
      hM3D Rev: CTTGAGCACGATGGAGTAGATG
    • Transgene (no product expected)
      hM4D For: TCACGTCATCATCCCACAATC
      hM4D Rev: CTGTCTGCTTCGTCACAATCT
    • Orientation
      CaMKII For: GACAGGAGCCCCAGGAGACCAA
      hM3D Rev: CTTGAGCACGATGGAGTAGATG
    • Orientation
      CaMKII For: GACAGGAGCCCCAGGAGACCAA
      Cherry Rev: CTTGTACAGCTCGTCCATGCCG
  • In-vivo expression: Expression data were kindly shared by scientists using Addgene's AAV in their labs. You can view the in-vivo expression and details here or in the image section at the top of this page.

Visit our viral production page for more information.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pAAV-CaMKIIa-hM3D(Gq)-mCherry was a gift from Bryan Roth (Addgene plasmid # 50476)