Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

pG-HIV-2LTR
(Plasmid #104590)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 104590 Standard format: Plasmid sent in bacteria as agar stab 1 $85

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    pGemT
  • Backbone manufacturer
    Promega
  • Backbone size w/o insert (bp) 3001
  • Vector type
    cloning vector

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    2LTR circle junction of HIV-1
  • Species
    HIV-1 virus

Cloning Information

  • Cloning method TOPO Cloning
  • 5′ sequencing primer T7-F TAATACGACTCACTATAGGG and SP6-F ATTTAGGTGACACTATAG
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

During HIV-1 infection, unintegrated viral cDNA may be circularized. The circularization generates a unique junction between the long terminal repeat (LTR) ends. HIV-1 2LTR circles have been quantified as measure of viral replication or entry of the viral cDNA into the host cell nucleus. The amplicon is 2672-2879 in the Addgene sequence file. This corresponds to HIV-1 strain HXB2 reference genome 9585-9719 bp (Addgene 2672-2806 bp) fused to 1 to 51 bp (Addgene 2829-2879 bp). In this plasmid there are 22 bp (Addgene 2807-2828 bp) of random sequence inserted between the HIV-1 ends. The insert may be amplified with primers MH535 (5' AACTAGGGAACCCACTGCTTAAG), MH536 (5' TCCACAGATCAAGGATATCTTGTC), and Taqman probe MH603 (5' ACACTACTTGAAGCACTCAAGGCAAGCTTT).

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pG-HIV-2LTR was a gift from Kristine Yoder (Addgene plasmid # 104590 ; http://n2t.net/addgene:104590 ; RRID:Addgene_104590)
  • For your References section:

    Real-time quantitative PCR and fast QPCR have similar sensitivity and accuracy with HIV cDNA late reverse transcripts and 2-LTR circles. Yoder KE, Fishel R. J Virol Methods. 2008 Nov;153(2):253-6. doi: 10.1016/j.jviromet.2008.07.032. Epub 2008 Sep 17. 10.1016/j.jviromet.2008.07.032 PubMed 18762215