Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

pICH47742:PtFCP:Cas9YFP
(Plasmid #104894)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 104894 Standard format: Plasmid sent in bacteria as agar stab 1 $85

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    pICH47742
  • Backbone size w/o insert (bp) 4968
  • Total vector size (bp) 9731
  • Vector type
    CRISPR ; ; Golden Gate Assembly

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    Cas9
  • Species
    Streptococcus pyogenes
  • Insert Size (bp)
    5382
  • Tag / Fusion Protein
    • YFP (C terminal on insert)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site BsaI (destroyed during cloning)
  • 3′ cloning site BsaI (destroyed during cloning)
  • 5′ sequencing primer ggataaaccttttcacgccc
  • (Common Sequencing Primers)

Resource Information

  • Supplemental Documents
  • A portion of this plasmid was derived from a plasmid made by
    Cas9:YFP described in Hopes A, Nekrasov V, Kamoun S, Mock T. Editing of the urease gene by CRISPR-Cas in the diatom Thalassiosira pseudonana. Phaeodactylum promoter and terminator from pPha-TI, described in Zaslavskaia L, Lippmeier C, Kroth P, Grossman A, Apt K. Transformation of the diatom Phaeodactylum tricornutum (Bacillariophyceae) with a variety of selectable marker and reporter genes. PtFCP promoter/terminator were domesticated by removing BpiI sites through site directed mutagenesis.

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

This construct was assembled using Golden Gate Cloning.

Please visit https://www.biorxiv.org/content/early/2018/10/17/444109 for bioRxiv preprint.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pICH47742:PtFCP:Cas9YFP was a gift from Thomas Mock (Addgene plasmid # 104894 ; http://n2t.net/addgene:104894 ; RRID:Addgene_104894)
  • For your References section:

    Biochemical Characterization of a Novel Redox-Regulated Metacaspase in a Marine Diatom. Graff van Creveld S, Ben-Dor S, Mizrachi A, Alcolombri U, Hopes A, Mock T, Rosenwasser S, Vardi A. Front Microbiol. 2021 Sep 8;12:688199. doi: 10.3389/fmicb.2021.688199. eCollection 2021. 10.3389/fmicb.2021.688199 PubMed 34566902