-
PurposeExpresses an sgRNA targeting the PDS gene in Nicotiana benthamiana from the Arabidopsis U6 promoter
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 46966 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonepICH86966
- Backbone size w/o insert (bp) 6340
- Total vector size (bp) 6552
-
Vector typeCRISPR ; Plant expression
-
Selectable markersKanamycin
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Growth instructionsGrows slowly, better incubate for 2 days
-
Copy numberLow Copy
Gene/Insert
-
Gene/Insert nameAtU6p::sgRNA_PDS
-
SpeciesSynthetic
-
Insert Size (bp)212
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site Bsa I (destroyed during cloning)
- 3′ cloning site Bsa I (destroyed during cloning)
- 5′ sequencing primer gtggtgtaaacaaattgacgc
- 3′ sequencing primer ggataaaccttttcacgccc (Common Sequencing Primers)
Resource Information
-
A portion of this plasmid was derived from a plasmid made byThe backbone vector pICH86966 comes from Sylvestre Marillonnet (Leibniz Institute of Plant Biochemistry, Germany)
-
Articles Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
For more information on Kamoun Lab CRISPR Plasmids please refer to: http://www.addgene.org/crispr/Kamoun/
gRNA target sequence GCCGTTAATTTGAGAGTCCA
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pICH86966::AtU6p::sgRNA_PDS was a gift from Sophien Kamoun (Addgene plasmid # 46966 ; http://n2t.net/addgene:46966 ; RRID:Addgene_46966) -
For your References section:
Targeted mutagenesis in the model plant Nicotiana benthamiana using Cas9 RNA-guided endonuclease. Nekrasov V, Staskawicz B, Weigel D, Jones JD, Kamoun S. Nat Biotechnol. 2013 Aug 8;31(8):691-3. doi: 10.1038/nbt.2655. 10.1038/nbt.2655 PubMed 23929340