Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected] Learn more

(Plasmid #46966)


Item Catalog # Description Quantity Price (USD)
Plasmid 46966 Standard format: Plasmid sent in bacteria as agar stab 1 $75

This material is available to academics and nonprofits only.


  • Vector backbone
  • Backbone size w/o insert (bp) 6340
  • Total vector size (bp) 6552
  • Vector type
    CRISPR ; Plant expression
  • Selectable markers

Growth in Bacteria

  • Bacterial Resistance(s)
  • Growth Temperature
  • Growth Strain(s)
  • Growth instructions
    Grows slowly, better incubate for 2 days
  • Copy number
    Low Copy


  • Gene/Insert name
  • Species
  • Insert Size (bp)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site Bsa I (destroyed during cloning)
  • 3′ cloning site Bsa I (destroyed during cloning)
  • 5′ sequencing primer gtggtgtaaacaaattgacgc
  • 3′ sequencing primer ggataaaccttttcacgccc
  • (Common Sequencing Primers)

Resource Information

  • A portion of this plasmid was derived from a plasmid made by
    The backbone vector pICH86966 comes from Sylvestre Marillonnet (Leibniz Institute of Plant Biochemistry, Germany)
  • Terms and Licenses
  • Industry Terms
    • Not Available to Industry
  • Articles Citing this Plasmid

Depositor Comments

For more information on Kamoun Lab CRISPR Plasmids please refer to:


How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pICH86966::AtU6p::sgRNA_PDS was a gift from Sophien Kamoun (Addgene plasmid # 46966 ; ; RRID:Addgene_46966)
  • For your References section:

    Targeted mutagenesis in the model plant Nicotiana benthamiana using Cas9 RNA-guided endonuclease. Nekrasov V, Staskawicz B, Weigel D, Jones JD, Kamoun S. Nat Biotechnol. 2013 Aug 8;31(8):691-3. doi: 10.1038/nbt.2655. 10.1038/nbt.2655 PubMed 23929340