Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

pET28a-mxLOX1
(Plasmid #104975)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 104975 Standard format: Plasmid sent in bacteria as agar stab 1 $85

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    pET 28a
  • Backbone manufacturer
    Novagen
  • Backbone size w/o insert (bp) 5369
  • Total vector size (bp) 7498
  • Vector type
    Bacterial Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Kanamycin, 50 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    MXAN_1745
  • Alt name
    mxLOX1
  • Species
    Myxococcus xanthus
  • Insert Size (bp)
    2148
  • GenBank ID
    ABF 86480.1
  • Entrez Gene
    MXAN_1745 (a.k.a. MXAN_1745)
  • Promoter T7 promoter
  • Tag / Fusion Protein
    • 6 histidine tag (N terminal on backbone)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site EcoRI (not destroyed)
  • 3′ cloning site NotI (not destroyed)
  • 5′ sequencing primer GGATTCATGAGCGCGAGTGTGA
  • 3′ sequencing primer GCGGCCGCTTAGATATTGATGC
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

Addgene sequencing data found H193Q in the MXAN_1745 translation, that does not affect protein function

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pET28a-mxLOX1 was a gift from Deokkun Oh (Addgene plasmid # 104975 ; http://n2t.net/addgene:104975 ; RRID:Addgene_104975)