pET28a-mxLOX1
(Plasmid
#104975)
-
PurposeBiosynthesis of oxylipins by microbial enzymes
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 104975 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonepET 28a
-
Backbone manufacturerNovagen
- Backbone size w/o insert (bp) 5369
- Total vector size (bp) 7498
-
Vector typeBacterial Expression
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameMXAN_1745
-
Alt namemxLOX1
-
SpeciesMyxococcus xanthus
-
Insert Size (bp)2148
-
GenBank IDABF 86480.1
-
Entrez GeneMXAN_1745 (a.k.a. MXAN_1745)
- Promoter T7 promoter
-
Tag
/ Fusion Protein
- 6 histidine tag (N terminal on backbone)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site EcoRI (not destroyed)
- 3′ cloning site NotI (not destroyed)
- 5′ sequencing primer GGATTCATGAGCGCGAGTGTGA
- 3′ sequencing primer GCGGCCGCTTAGATATTGATGC (Common Sequencing Primers)
Resource Information
-
Article Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Addgene sequencing data found H193Q in the MXAN_1745 translation, that does not affect protein function
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pET28a-mxLOX1 was a gift from Deokkun Oh (Addgene plasmid # 104975 ; http://n2t.net/addgene:104975 ; RRID:Addgene_104975)