Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Addgene is open for ordering and depositing; find up-to-date details here. To learn more about how we are supporting COVID-19 research and to find related plasmids, check out our COVID-19 and Coronavirus Plasmids & Resources page.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected] Learn more

pGP-AAV-syn-FLEX-jGCaMP7c variant 1513-WPRE
(Plasmid #105322)


Item Catalog # Description Quantity Price (USD)
Plasmid 105322 Standard format: Plasmid sent in bacteria as agar stab 1 $75
AAV1 105322-AAV1 100 µL at titer ≥ 7×10¹² vg/mL and Plasmid.

This material is available to academics and nonprofits only.


  • Vector backbone
  • Backbone manufacturer
    Scott Sternson
  • Backbone size w/o insert (bp) 4894
  • Total vector size (bp) 6247
  • Vector type
    Mammalian Expression, AAV, Cre/Lox

Growth in Bacteria

  • Bacterial Resistance(s)
  • Growth Temperature
  • Growth Strain(s)
    NEB Stable
  • Copy number
    Low Copy


  • Gene/Insert name
    jGCaMP7c variant 1513
  • Alt name
    GCaMP3-L59Q E60P T302L R303P M378G K379S D380Y T381R R392G T412N
  • Alt name
    GCaMP3 variant 1513
  • Alt name
    Janelia GCaMP7
  • Species
    R. norvegicus (rat), G. gallus (chicken); A. victoria (jellyfish)
  • Insert Size (bp)
  • Promoter Synapsin
  • Tag / Fusion Protein
    • T7 epitope, Xpress tag, 6xHis

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site BsmBI (destroyed during cloning)
  • 3′ cloning site BsmBI (destroyed during cloning)
  • 5′ sequencing primer ACCACGCGAGGCGCGAGATAG
  • (Common Sequencing Primers)

Resource Information

Information for AAV1 (Catalog # 105322-AAV1) ( Back to top )


Ready-to-use AAV1 particles produced from pGP-AAV-syn-FLEX-jGCaMP7c variant 1513-WPRE (#105322). In addition to the viral particles, you will also receive purified pGP-AAV-syn-FLEX-jGCaMP7c variant 1513-WPRE plasmid DNA.

Synapsin-driven, Cre-dependent jGCaMP7c expression. jGCaMP7c exhibits high contrast between peak fluorescence and resting fluorescence. It is useful for activity imaging of large populations of densely-labeled neurons because background fluorescence from inactive neurons is reduced. These AAV preparations are suitable purity for injection into animals.


  • Volume 100 µL
  • Titer ≥ 7×10¹² vg/mL
  • Pricing $350 USD for preparation of 100 µL virus + $30 USD for plasmid.
  • Storage Store at -80℃. Thaw just before use and keep on ice.
  • Shipment Viral particles are shipped frozen on dry ice. Plasmid DNA (≥ 200ng) will also be included in the shipment.

Viral Production & Use

  • Packaging Plasmids encode adenoviral helper sequences and AAV rep gene, AAV1 cap gene
  • Buffer PBS + 0.001% Pluronic F-68 + 200 mM NaCl
  • Serotype AAV1
  • Purification Iodixanol gradient ultracentrifugation


Requestor is responsible for compliance with their institution's biosafety regulations. Lentivirus is generally considered BSL-2. AAV is generally considered BSL-1, but may require BSL-2 handling depending on the insert. Biosafety Guide

Resource Information

Viral Quality Control

Quality Control:
  • Addgene ensures high quality viral vectors by optimizing and standardizing production protocols and performing rigorous quality control (QC) (see a list of our QC assays). The specific QC assays performed varies for each viral lot. To learn which specific QC assays were performed on your lot, please contact us.
  • Titer: the exact titer of your sample will be reported on the tube. The titer you see listed on this page is the guaranteed minimum titer. See how titers are measured.

Visit our viral production page for more information.

Addgene Comments

Using FLEX vectors in vivo: LoxP sites in FLEX plasmids are known to recombine during DNA amplification and viral vector production, which may result in a minority of Cre-activated (i.e., "flipped") viral vectors. Addgene has measured this occurs in 0.01-0.03% of viral vectors in our typical production protocol. This can lead to a small number of cells exhibiting Cre-independent transgene expression in vivo. To address this, we recommend titrating to find the optimal AAV dosage required for Cre-dependent transgene expression and function in vivo. This may include reducing the viral vector dosage in order to reduce the likelihood of Cre-independent expression.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pGP-AAV-syn-FLEX-jGCaMP7c variant 1513-WPRE was a gift from Douglas Kim & GENIE Project (Addgene plasmid # 105322 ; ; RRID:Addgene_105322)

    For viral preps, please replace (Addgene plasmid # 105322) in the above sentence with: (Addgene viral prep # 105322-AAV1)

  • For your References section:

    High-performance GFP-based calcium indicators for imaging activity in neuronal populations and microcompartments. Dana H, Sun Y, Mohar B, Hulse B, Hasseman JP, Tsegaye G, Tsang A, Wong A, Patel R, Macklin JJ, Chen Y, Konnerth A, Jayaraman V, Looger LL, Schreiter ER, Svoboda K, Kim DS.. bioRxiv 434589 10.1101/434589