pAAV-Ef1a-DIO-Synaptophysin-GCaMP6s
(Plasmid #105715)

• Purpose: In the presence of Cre, the plasmid can be used to express GCaMP6s fused to the presynaptic protein synaptophysin. Drives enriched expression of GCaMP6s in neuronal axon boutons.
• Depositing Lab: Rylan Larsen
• Publication: AAV GCaMP6 Plasmids (unpublished)

Ordering

Item	Catalog #	Description	Quantity	Price (USD)
Plasmid	105715	Standard format: Plasmid sent in bacteria as agar stab	1	$75	Add to Cart

This material is available to academics and nonprofits only.

Backbone

• Vector backbone: pAAV-EF1a-Flpo
  (Search Vector Database)
• Backbone manufacturer: Karl Deisseroth
• Backbone size w/o insert (bp): 6109
• Total vector size (bp): 7465
• Modifications to backbone: The post-transcriptional regulatory WPRE was replaced by WPRE3. The hGH polyA sequence was replaced by SV40pA.
• Vector type: Mammalian Expression, AAV, Cre/Lox

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin
• Growth Temperature: 37°C
• Growth Strain(s): NEB Stable
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: synaptophysin-GCaMP6s
• Alt name: synaptophysin-GCaMP3-K78H T302L R303P D380Y T381R S383T R392G
• Species: R. norvegicus (rat); A. victoria (jellyfish)
• Insert Size (bp): 1274
• GenBank ID: 24804
• Promoter: Ef1a, Human elongation factor-1 alpha

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: AscI (not destroyed)
• 3′ cloning site: RsrII (destroyed during cloning)
• 5′ sequencing primer: acttctctccaaggtttgtc
• 3′ sequencing primer: ttgatatcgaattcataact

Resource Information

• Supplemental Documents:
  • Restriction Digest - SmaI
  • AAV_Ef1a_DIO_SynGCaMP6s_WPRE3_SV40_.gb
• A portion of this plasmid was derived from a plasmid made by: GCaMP6s was synthesized de novo based on sequences published by Douglas Kim et al, Janelia Research Campus in Chen et al, 2013 PMID: 23868258. The Synaptophysin-GCaMP6s fusion sequence was previously published by Ofer Yizhar's lab in Mahn et al, 2016 PMID: 26950004
• Terms and Licenses:
  • UBMTA
  • Ancillary Agreement for Plasmids Containing FP Materials
  • genOway Notice of RIghts
• Industry Terms:
  • Not Available to Industry