pAAV-Ef1a-DIO-Synaptophysin-GCaMP6s
(Plasmid
#105715)
-
PurposeIn the presence of Cre, the plasmid can be used to express GCaMP6s fused to the presynaptic protein synaptophysin. Drives enriched expression of GCaMP6s in neuronal axon boutons.
-
Depositing Lab
-
Publication
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | ||
---|---|---|---|---|---|---|
Plasmid | 105715 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $75 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonepAAV-EF1a-Flpo
-
Backbone manufacturerKarl Deisseroth
- Backbone size w/o insert (bp) 6109
- Total vector size (bp) 7465
-
Modifications to backboneThe post-transcriptional regulatory WPRE was replaced by WPRE3. The hGH polyA sequence was replaced by SV40pA.
-
Vector typeMammalian Expression, AAV, Cre/Lox
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert namesynaptophysin-GCaMP6s
-
Alt namesynaptophysin-GCaMP3-K78H T302L R303P D380Y T381R S383T R392G
-
SpeciesR. norvegicus (rat); A. victoria (jellyfish)
-
Insert Size (bp)1274
-
GenBank ID24804
- Promoter Ef1a, Human elongation factor-1 alpha
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site AscI (not destroyed)
- 3′ cloning site RsrII (destroyed during cloning)
- 5′ sequencing primer acttctctccaaggtttgtc
- 3′ sequencing primer ttgatatcgaattcataact (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
-
A portion of this plasmid was derived from a plasmid made byGCaMP6s was synthesized de novo based on sequences published by Douglas Kim et al, Janelia Research Campus in Chen et al, 2013 PMID: 23868258. The Synaptophysin-GCaMP6s fusion sequence was previously published by Ofer Yizhar's lab in Mahn et al, 2016 PMID: 26950004
-
Terms and Licenses
-
Industry Terms
- Not Available to Industry
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pAAV-Ef1a-DIO-Synaptophysin-GCaMP6s was a gift from Rylan Larsen (Addgene plasmid # 105715 ; http://n2t.net/addgene:105715 ; RRID:Addgene_105715)