pAAV-Ef1a-DIO-Synaptophysin-GCaMP6s
(Plasmid #105715)

Purpose

In the presence of Cre, the plasmid can be used to express GCaMP6s fused to the presynaptic protein synaptophysin. Drives enriched expression of GCaMP6s in neuronal axon boutons.
Depositing Lab

Rylan Larsen
Publication

AAV GCaMP6 Plasmids (unpublished) ( How to cite )
Sequence Information
- Sequences (1)

Ordering

Item	Catalog #	Description	Quantity	Price (USD)
Plasmid	105715	Standard format: Plasmid sent in bacteria as agar stab	1	$75	Add to Cart

This material is available to academics and nonprofits only.

Backbone

Vector backbone
pAAV-EF1a-Flpo
(Search Vector Database)
Backbone manufacturer
Karl Deisseroth
Backbone size w/o insert (bp) 6109
Total vector size (bp) 7465
Modifications to backbone
The post-transcriptional regulatory WPRE was replaced by WPRE3. The hGH polyA sequence was replaced by SV40pA.
Vector type
Mammalian Expression, AAV, Cre/Lox

Growth in Bacteria

Bacterial Resistance(s)
Ampicillin
Growth Temperature
37°C
Growth Strain(s)
NEB Stable
Copy number
High Copy

Gene/Insert

Gene/Insert name
synaptophysin-GCaMP6s
Alt name
synaptophysin-GCaMP3-K78H T302L R303P D380Y T381R S383T R392G
Species
R. norvegicus (rat); A. victoria (jellyfish)
Insert Size (bp)
1274
GenBank ID
24804
Promoter Ef1a, Human elongation factor-1 alpha

Cloning Information

Cloning method Restriction Enzyme
5′ cloning site AscI (not destroyed)
3′ cloning site RsrII (destroyed during cloning)
5′ sequencing primer acttctctccaaggtttgtc
3′ sequencing primer ttgatatcgaattcataact

(Common Sequencing Primers)

Resource Information

Supplemental Documents
- Restriction Digest - SmaI
- AAV_Ef1a_DIO_SynGCaMP6s_WPRE3_SV40_.gb
A portion of this plasmid was derived from a plasmid made by
GCaMP6s was synthesized de novo based on sequences published by Douglas Kim et al, Janelia Research Campus in Chen et al, 2013 PMID: 23868258. The Synaptophysin-GCaMP6s fusion sequence was previously published by Ofer Yizhar's lab in Mahn et al, 2016 PMID: 26950004
Terms and Licenses

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

For your Materials & Methods section:

pAAV-Ef1a-DIO-Synaptophysin-GCaMP6s was a gift from Rylan Larsen (Addgene plasmid # 105715 ; http://n2t.net/addgene:105715 ; RRID:Addgene_105715)

Map uploaded by the depositor.

pAAV-Ef1a-DIO-Synaptophysin-GCaMP6s (Plasmid #105715)