Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected] Learn more

(Plasmid #105715)


Item Catalog # Description Quantity Price (USD)
Plasmid 105715 Standard format: Plasmid sent in bacteria as agar stab 1 $75

This material is available to academics and nonprofits only.


  • Vector backbone
  • Backbone manufacturer
    Karl Deisseroth
  • Backbone size w/o insert (bp) 6109
  • Total vector size (bp) 7465
  • Modifications to backbone
    The post-transcriptional regulatory WPRE was replaced by WPRE3. The hGH polyA sequence was replaced by SV40pA.
  • Vector type
    Mammalian Expression, AAV, Cre/Lox

Growth in Bacteria

  • Bacterial Resistance(s)
  • Growth Temperature
  • Growth Strain(s)
    NEB Stable
  • Copy number
    High Copy


  • Gene/Insert name
  • Alt name
    synaptophysin-GCaMP3-K78H T302L R303P D380Y T381R S383T R392G
  • Species
    R. norvegicus (rat); A. victoria (jellyfish)
  • Insert Size (bp)
  • GenBank ID
  • Promoter Ef1a, Human elongation factor-1 alpha

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site AscI (not destroyed)
  • 3′ cloning site RsrII (destroyed during cloning)
  • 5′ sequencing primer acttctctccaaggtttgtc
  • 3′ sequencing primer ttgatatcgaattcataact
  • (Common Sequencing Primers)

Resource Information

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pAAV-Ef1a-DIO-Synaptophysin-GCaMP6s was a gift from Rylan Larsen (Addgene plasmid # 105715 ; ; RRID:Addgene_105715)