pLenti- V6.3 Ultra
(Plasmid
#106172)
-
Purposelentiviral CMV driven eGFP-P2A-T2A, Blasticidin selectable
-
Depositing Lab
-
Publication
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 106172 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonepLenti6.3/TO/V5-DEST
-
Backbone manufacturerinvitrogen
- Backbone size w/o insert (bp) 9351
- Total vector size (bp) 8656
-
Modifications to backbonepUltra-eGFP and P2A-T2A MCS cloned into pLenti 6.3 (through in-fusion cloning, linearized through PstI and SalI digestion, restriction sites maintained)
-
Vector typeMammalian Expression, Lentiviral
-
Selectable markersBlasticidin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameeGFP
-
SpeciesSynthetic
-
Insert Size (bp)717
- Promoter CMV
-
Tag
/ Fusion Protein
- T2A, P2A
Cloning Information
- Cloning method Unknown
- 5′ sequencing primer CGCAAATGGGCGGTAGGCGTG
- 3′ sequencing primer TTGGTCACCTTCAGCTTGG (Common Sequencing Primers)
Resource Information
-
A portion of this plasmid was derived from a plasmid made byinsert derived from pUltra (Plasmid #24129)
-
Articles Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pLenti- V6.3 Ultra was a gift from Ewa Snaar-Jagalska (Addgene plasmid # 106172 ; http://n2t.net/addgene:106172 ; RRID:Addgene_106172)