Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected] Learn more

(Plasmid #106435)


Item Catalog # Description Quantity Price (USD)
Plasmid 106435 Standard format: Plasmid sent in bacteria as agar stab 1 $65

This material is available to academics and nonprofits only.


  • Vector backbone
  • Vector type
    Plant Expression, CRISPR, Synthetic Biology
  • Selectable markers

Growth in Bacteria

  • Bacterial Resistance(s)
  • Growth Temperature
  • Growth Strain(s)
  • Copy number


  • Gene/Insert name
  • Alt name
  • Alt name
    gRNA: acggaaagatgtatgggctt
  • Species
    H. sapiens (human), A. thaliana (mustard weed), Synthetic
  • Insert Size (bp)

Resource Information

  • A portion of this plasmid was derived from a plasmid made by
    Portions of the SunTagFWAg4-22aa-TET1cd were amplified from Addgene plasmid # 60903 and # 60904, gifts from Ron Vale. The pMOA34 backbone was a gift from Zachary Nimchuk.
  • Terms and Licenses
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    SunTag-FWAgRNA-4-22aa-TET1cd was a gift from Steven Jacobsen (Addgene plasmid # 106435 ; ; RRID:Addgene_106435)
  • For your References section:

    Targeted DNA demethylation of the Arabidopsis genome using the human TET1 catalytic domain. Gallego-Bartolome J, Gardiner J, Liu W, Papikian A, Ghoshal B, Kuo HY, Zhao JM, Segal DJ, Jacobsen SE. Proc Natl Acad Sci U S A. 2018 Feb 27;115(9):E2125-E2134. doi: 10.1073/pnas.1716945115. Epub 2018 Feb 14. 10.1073/pnas.1716945115 PubMed 29444862