Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected] Learn more

AAV_CWSL.nEF.DIO.Synaptophysin-GCaMP6s.P2A.mRuby3
(Plasmid #107736)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 107736 Standard format: Plasmid sent in bacteria as agar stab 1 $75

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    pAAV-CW3SL-EGFP
  • Backbone manufacturer
    Bong-Kiun Kaang
  • Backbone size w/o insert (bp) 3372
  • Total vector size (bp) 7305
  • Modifications to backbone
    A fragment containing the nEF promoter, LoxP/Lox2272, and reverse-complemented Synaptophysin-GCaMP6s.P2A.mRuby3 was swapped into replace EGFP and the shortened CamKII promoter in the CW3SL backbone. Total AAV packaging size (including ITRs and DNA in between) is 4681 bp.
  • Vector type
    Mammalian Expression, AAV, Cre/Lox

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    synaptophysin-GCaMP6s, mRuby3
  • Alt name
    synaptophysin-GCaMP3-K78H T302L R303P D380Y T381R S383T R392G
  • Alt name
    mRuby3
  • Species
    R. norvegicus (rat); A. victoria (jellyfish)
  • GenBank ID
    24804
  • Promoter nEF

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site Pci (not destroyed)
  • 3′ cloning site SciI (destroyed during cloning)
  • 5′ sequencing primer CCTGGCCTTTTGCTGGCCTTTTGC
  • 3′ sequencing primer ATCCAGAGGTTGATTATCTC
  • (Common Sequencing Primers)

Resource Information

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    AAV_CWSL.nEF.DIO.Synaptophysin-GCaMP6s.P2A.mRuby3 was a gift from Rylan Larsen (Addgene plasmid # 107736 ; http://n2t.net/addgene:107736 ; RRID:Addgene_107736)