Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected] Learn more

pTRIPZ-EGFP:LIMD1
(Plasmid #108230)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 108230 Standard format: Plasmid sent in bacteria as agar stab 1 $75

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    pTRIPZ
  • Backbone manufacturer
    GE Healthcare
  • Backbone size w/o insert (bp) 13320
  • Total vector size (bp) 15429
  • Vector type
    Mammalian Expression, Lentiviral
  • Selectable markers
    Puromycin

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    LIMD1
  • Species
    H. sapiens (human)
  • Insert Size (bp)
    2853
  • GenBank ID
    NM_014240.2
  • Entrez Gene
    LIMD1
  • Promoter Tet/ON Minimal CMV promoter
  • Tag / Fusion Protein
    • EGFP (N terminal on insert)

Cloning Information

  • Cloning method Gibson Cloning
  • 5′ sequencing primer GAACCGTCAGATCGCAATGGTGAGCAAGGGCGAG
  • 3′ sequencing primer CCTCATTCAAACAAACTATTAAAGCAAGTAAAACCTCTACAAATGTG
  • (Common Sequencing Primers)

Resource Information

Depositor Comments

Please note that due to a cloning artifact, the amino acids SLDN were added to the C-terminus of LIMD1. The construct will function as described in the associated publication.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pTRIPZ-EGFP:LIMD1 was a gift from Kenneth Irvine (Addgene plasmid # 108230 ; http://n2t.net/addgene:108230 ; RRID:Addgene_108230)
  • For your References section:

    Tension-dependent regulation of mammalian Hippo signaling through LIMD1. Ibar C, Kirichenko E, Keepers B, Enners E, Fleisch K, Irvine KD. J Cell Sci. 2018 Feb 13. pii: jcs.214700. doi: 10.1242/jcs.214700. 10.1242/jcs.214700 PubMed 29440237