-
PurposeExpresses activated human KRAS G12C (amino acids 1 - 169) in E. coli with amino terminal 6xHIS and FLAG tags that can be removed with TEV protease.
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 111848 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonepDNA2.0
-
Backbone manufacturerATUM
- Backbone size w/o insert (bp) 3936
- Total vector size (bp) 4533
-
Modifications to backboneNone
-
Vector typeBacterial Expression
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameKRAS G12C
-
Alt nameKirsten ras oncogene G12C
-
SpeciesH. sapiens (human)
-
Insert Size (bp)507
-
MutationChanged Glycine 12 to Cysteine
-
Entrez GeneKRAS (a.k.a. 'C-K-RAS, C-K-RAS, CFC2, K-RAS2A, K-RAS2B, K-RAS4A, K-RAS4B, K-Ras, K-Ras 2, KI-RAS, KRAS1, KRAS2, NS, NS3, OES, RALD, RASK2, c-Ki-ras, c-Ki-ras2)
- Promoter T5
-
Tags
/ Fusion Proteins
- 6xHis-tag (N terminal on backbone)
- FLAG-tag (N terminal on backbone)
- TEV protease cleavage sequence (N terminal on backbone)
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer GGAATTGTGAGCGCTCACAA
- 3′ sequencing primer GAACTGCCAGGCATCAAATAAAA (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pDNA2.0 6H-FLAG-TEV-KRAS G12C was a gift from Kenneth Westover (Addgene plasmid # 111848 ; http://n2t.net/addgene:111848 ; RRID:Addgene_111848) -
For your References section:
Biochemical and Structural Analysis of Common Cancer-Associated KRAS Mutations. Hunter JC, Manandhar A, Carrasco MA, Gurbani D, Gondi S, Westover KD. Mol Cancer Res. 2015 Sep;13(9):1325-35. doi: 10.1158/1541-7786.MCR-15-0203. Epub 2015 Jun 2. 10.1158/1541-7786.MCR-15-0203 PubMed 26037647