Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

pDNA2.0 6H-TEV-KRAS
(Plasmid #111849)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 111849 Standard format: Plasmid sent in bacteria as agar stab 1 $85

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    pDNA2.0
  • Backbone manufacturer
    ATUM
  • Backbone size w/o insert (bp) 3939
  • Total vector size (bp) 4500
  • Modifications to backbone
    None
  • Vector type
    Bacterial Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Kanamycin, 50 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    KRAS
  • Alt name
    Kirsten ras oncogene
  • Species
    H. sapiens (human)
  • Insert Size (bp)
    507
  • Entrez Gene
    KRAS (a.k.a. 'C-K-RAS, C-K-RAS, CFC2, K-RAS2A, K-RAS2B, K-RAS4A, K-RAS4B, K-Ras, K-Ras 2, KI-RAS, KRAS1, KRAS2, NS, NS3, OES, RALD, RASK2, c-Ki-ras, c-Ki-ras2)
  • Promoter T5
  • Tags / Fusion Proteins
    • 6xHis-tag
    • TEV protease cleavage sequence

Cloning Information

  • Cloning method Gibson Cloning
  • 5′ sequencing primer GGAATTGTGAGCGCTCACAA
  • 3′ sequencing primer GAACTGCCAGGCATCAAATAAAA
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pDNA2.0 6H-TEV-KRAS was a gift from Kenneth Westover (Addgene plasmid # 111849 ; http://n2t.net/addgene:111849 ; RRID:Addgene_111849)
  • For your References section:

    Biochemical and Structural Analysis of Common Cancer-Associated KRAS Mutations. Hunter JC, Manandhar A, Carrasco MA, Gurbani D, Gondi S, Westover KD. Mol Cancer Res. 2015 Sep;13(9):1325-35. doi: 10.1158/1541-7786.MCR-15-0203. Epub 2015 Jun 2. 10.1158/1541-7786.MCR-15-0203 PubMed 26037647