Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected] Learn more

(Plasmid #111934)


Item Catalog # Description Quantity Price (USD)
Plasmid 111934 Standard format: Plasmid sent in bacteria as agar stab 1 $75

This material is available to academics and nonprofits only.


Growth in Bacteria

  • Bacterial Resistance(s)
  • Growth Temperature
  • Growth Strain(s)
  • Copy number
    High Copy


  • Gene/Insert name
    Signal transducer and activator of transcription 3
  • Alt name
  • Alt name
  • Species
    H. sapiens (human)
  • Insert Size (bp)
  • GenBank ID
  • Entrez Gene
    STAT3 (a.k.a. ADMIO, ADMIO1, APRF, HIES)
  • Promoter CMV
  • Tag / Fusion Protein
    • GFP (C terminal on insert)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site HindIII (not destroyed)
  • 3′ cloning site AgeI (not destroyed)
  • 5′ sequencing primer TAACAACTCCGCCCCATT
  • 3′ sequencing primer GTCCAGCTCGACCAGGATGGG
  • (Common Sequencing Primers)

Resource Information

  • A portion of this plasmid was derived from a plasmid made by
    Synthetic gene from Genscript
  • Article Citing this Plasmid

Terms and Licenses

  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pEGFP-N1-STAT3 was a gift from Geert van den Bogaart (Addgene plasmid # 111934 ; ; RRID:Addgene_111934)
  • For your References section:

    Interleukin-6 secretion is limited by self-signaling in endosomes. Verboogen DRJ, Revelo NH, Ter Beest M, van den Bogaart G. J Mol Cell Biol. 2018 Jul 16. pii: 5054600. doi: 10.1093/jmcb/mjy038. 10.1093/jmcb/mjy038 PubMed 30016456