pBS-I-Sce1-eno2:Tau-IRES-egfp
(Plasmid
#112205)
-
PurposeUsed to make transgenic zebrafish expressing human 4R/0N Tau under the neuronal eno2 promoter
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | ||
---|---|---|---|---|---|---|
Plasmid | 112205 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $75 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonepBlueScript-ISce1
- Total vector size (bp) 16000
-
Vector typezebrafish expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberLow Copy
Gene/Insert
-
Gene/Insert nameMAPT
-
Alt nameTau
-
SpeciesH. sapiens (human)
-
Entrez GeneMAPT (a.k.a. DDPAC, FTDP-17, MAPTL, MSTD, MTBT1, MTBT2, PPND, PPP1R103, TAU)
- Promoter eno2 from zebrafish
-
Tag
/ Fusion Protein
- eno2 exon 2 translational fusion, ires-egfp at c terminal
Cloning Information
- Cloning method Ligation Independent Cloning
- 5′ sequencing primer TGGCTTTGCTCTTATCCAAT
- 3′ sequencing primer TACAAATGTGGTATGGCTGA (Common Sequencing Primers)
Resource Information
-
A portion of this plasmid was derived from a plasmid made byMAPT cDNA from Matt Farrer at Mayo Jacksonville
-
Terms and Licenses
-
Industry Terms
- Not Available to Industry
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pBS-I-Sce1-eno2:Tau-IRES-egfp was a gift from Edward Burton (Addgene plasmid # 112205 ; http://n2t.net/addgene:112205 ; RRID:Addgene_112205) -
For your References section:
Generation of a transgenic zebrafish model of Tauopathy using a novel promoter element derived from the zebrafish eno2 gene. Bai Q, Garver JA, Hukriede NA, Burton EA. Nucleic Acids Res. 2007;35(19):6501-16. Epub 2007 Sep 25. 10.1093/nar/gkm608 PubMed 17897967