1
Plasmid 11338: pLexA::lis-1
  • lis-1

  • 1200

  • C. elegans (nematode)

  • NM_067354

  • lis-1 ()

  • LexA DNA Binding Domain

  • N terminal on backbone

  • pLexA
    (Search Vector Database)

  • see pLexA map in "author's map"

  • Yeast Expression

  • 5700

  • EcoRI

  • No

  • PstI

  • No

  • LexA sequencing primer (CGTCAGCAGAGCTTCACCATTG) List of Sequencing Primers

  • Ampicillin

  • DH5alpha

  • 37

  • High Copy

  • TRP1

  • View sequences (1)
  • View map

  • Guy Caldwell

  • UBMTA

Comments: 

Full-length cDNA for C. elegans open-reading frame T03F6.5, encoding the lis-1 gene, cloned into the yeast two-hybrid DNA-binding domain vector pLexA. This vector can be used as the bait for a yeast two-hybrid screen. See "author's map" for picture of empty pLexA vector.

This plasmid is intended for use exclusively as a teaching resource as part of the Integrated Genomics Discovery-Based Laboratory Course. Addgene does not make any guarantee that the plasmid is suitable for research purposes.

Addgene has sequenced a portion of this plasmid for verification. Full plasmid sequence is available only if provided by the depositing laboratory.

Please acknowledge the principal investigator and cite this article if you use this plasmid in a publication. Also, please include the text "Addgene plasmid 11338" in your Materials and Methods section.