Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at Learn more

(Plasmid #11338)

Full plasmid sequence is not available for this item.

Item Catalog # Description Quantity Price (USD)
Plasmid 11338 Plasmid sent as bacteria in agar stab 1 $65

This material is available to academics and nonprofits only.

  • Vector backbone
  • Backbone manufacturer
    see pLexA map in "author's map"
  • Backbone size w/o insert (bp) 5700
  • Vector type
    Yeast Expression
  • Selectable markers

Growth in Bacteria

  • Bacterial Resistance(s)
  • Growth Temperature
  • Growth Strain(s)
  • Copy number
    High Copy

  • Gene/Insert name
  • Species
    C. elegans (nematode)
  • Insert Size (bp)
  • GenBank ID
  • Entrez Gene
  • Tag / Fusion Protein
    • LexA DNA Binding Domain (N terminal on backbone)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site EcoRI (not destroyed)
  • 3′ cloning site PstI (not destroyed)
  • 5′ sequencing primer LexA sequencing primer (CGTCAGCAGAGCTTCACCATTG)
  • (Common Sequencing Primers)

Resource Information

  • Terms and Licenses

Depositor Comments

Full-length cDNA for C. elegans open-reading frame T03F6.5, encoding the lis-1 gene, cloned into the yeast two-hybrid DNA-binding domain vector pLexA. This vector can be used as the bait for a yeast two-hybrid screen. See "author's map" for picture of empty pLexA vector.

This plasmid is intended for use exclusively as a teaching resource as part of the Integrated Genomics Discovery-Based Laboratory Course. Addgene does not make any guarantee that the plasmid is suitable for research purposes.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pLexA::lis-1 was a gift from Guy Caldwell (Addgene plasmid # 11338)