1
Plasmid 11338: pLexA::lis-1
  • lis-1

  • 1200

  • C. elegans (nematode)

  • NM_067354

  • lis-1 ()

  • LexA DNA Binding Domain

  • N terminal on backbone

  • pLexA
    (Search Vector Database)

  • see pLexA map in "author's map"

  • Yeast Expression

  • 5700

  • EcoRI

  • No

  • PstI

  • No

  • LexA sequencing primer (CGTCAGCAGAGCTTCACCATTG) List of Sequencing Primers

  • Ampicillin

  • DH5alpha

  • 37

  • High Copy

  • TRP1

  • View sequences (1)
  • View map

  • Guy Caldwell

  • MTA

Comments: 

Full-length cDNA for C. elegans open-reading frame T03F6.5, encoding the lis-1 gene, cloned into the yeast two-hybrid DNA-binding domain vector pLexA. This vector can be used as the bait for a yeast two-hybrid screen. See "author's map" for picture of empty pLexA vector.

This plasmid is intended for use exclusively as a teaching resource as part of the Integrated Genomics Discovery-Based Laboratory Course. Addgene does not make any guarantee that the plasmid is suitable for research purposes.

Addgene has sequenced a portion of this plasmid for verification. Click here for the sequencing result.

Please acknowledge the principal investigator and cite this article if you use this plasmid in a publication. Also, please include the text "Addgene plasmid 11338" in your Materials and Methods section.