pLexA::lis-1
(Plasmid #11338)

Available to Academic and Nonprofits Only

Backbone

  • Vector backbone
    pLexA
  • Backbone manufacturer
    see pLexA map in "author's map"
  • Backbone size w/o insert (bp) 5700
  • Vector type
    Yeast Expression
  • Selectable markers
    TRP1

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Sequence Information

Full plasmid sequence is available only if provided by the depositing laboratory.

Gene/Insert

  • Gene/Insert name
    lis-1
  • Species
    C. elegans (nematode)
  • Insert Size (bp)
    1200
  • GenBank ID
    NM_067354
  • Entrez Gene
    lis-1
  • Tag / Fusion Protein
    • LexA DNA Binding Domain (N terminal on backbone)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site EcoRI (not destroyed)
  • 3′ cloning site PstI (not destroyed)
  • 5′ sequencing primer LexA sequencing primer (CGTCAGCAGAGCTTCACCATTG)
  • (Common Sequencing Primers)

Resource Information

  • Terms and Licenses

Depositor Comments

Full-length cDNA for C. elegans open-reading frame T03F6.5, encoding the lis-1 gene, cloned into the yeast two-hybrid DNA-binding domain vector pLexA. This vector can be used as the bait for a yeast two-hybrid screen. See "author's map" for picture of empty pLexA vector.

This plasmid is intended for use exclusively as a teaching resource as part of the Integrated Genomics Discovery-Based Laboratory Course. Addgene does not make any guarantee that the plasmid is suitable for research purposes.

How to cite this plasmid

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pLexA::lis-1 was a gift from Guy Caldwell (Addgene plasmid # 11338)