pLexAgtwy
(Plasmid #11345)

• Depositing Lab: Guy Caldwell
• Publication: Integrated Genomics (unpublished)

Backbone

• Vector backbone: pLexA
• Backbone manufacturer: see map of pLexA in "author's map"
• Backbone size w/o insert (bp): 5700
• Vector type: Yeast Expression
• Selectable markers: TRP1

Growth in Bacteria

• Bacterial Resistance(s): Chloramphenicol and Ampicillin, 25 & 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): ccdB Survival
• Growth instructions: This vector is propagated in E. coli strain DB3.1, due to the requirement to circumvent the lethality of the inherent ccdB gene until an insert is recombined into the Gateway cassette.
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: gateway cassette

Cloning Information

• Cloning method: Gateway Cloning
• 5′ cloning site: SmaI (unknown if destroyed)
• 3′ cloning site: SmaI (unknown if destroyed)
• 5′ sequencing primer: LexA sequencing primer (CGTCAGCAGAGCTTCACCATTG)

Resource Information

• Articles Citing this Plasmid:
  • 2 References

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

Depositor Comments

Gateway-modified yeast two-hybrid DNA-binding domain vector. Use this vector for Gateway cloning of a cDNA to be used as the bait in a yeast two-hybrid screen. This vector was modified from plasmid pLexA by placing a Gateway acceptor cassette in the SmaI site of pLexA. To facilitate subcloning of a given DNA insert into this plasmid, Gateway recombinational attachment sites should be incorporated into primers used for amplificiation, as outlined in the Invitrogen Gateway manual. Gateway recombinational cassettes should be added to primers as outlined in the Invitrogen Gateway manual. (Gateway is a registered trademark of Invitrogen Corporation). Please note that the "author's map" is the map of the original pLexA vector upon which pLexAgtwy is derived - it is not a map of pLexAgtwy.

This plasmid is intended for use exclusively as a teaching resource as part of the Integrated Genomics Discovery-Based Laboratory Course. Addgene does not make any guarantee that the plasmid is suitable for research purposes.