Addgene - pLexAgtwy Plasmid Data

Plasmid 11345: pLexAgtwy

Gene/insert name:
gateway cassette
Vector backbone:
pLexA
(Search Vector Database)
Backbone manufacturer:
see map of pLexA in "author's map"
Vector type:
Yeast Expression
Backbone size w/o insert (bp):
5700
Cloning method:
Gateway Cloning
Cloning site 5':
SmaI
Site destroyed during cloning:
Unknown
Cloning site 3':
SmaI
Site destroyed during cloning:
Unknown
5' sequencing primer:
LexA sequencing primer (CGTCAGCAGAGCTTCACCATTG) List of Sequencing Primers
Bacterial resistance(s)
Ampicillin
Growth strain(s)
DB3.1
Growth temperature (℃):
37
Growth instructions:
This vector is propagated in E. coli strain DB3.1, due to the requirement to circumvent the lethality of the inherent ccdB gene until an insert is recombined into the Gateway cassette.
High or low copy:
High Copy
Selectable markers:
TRP1
Sequence: View sequences (1)
Map:
View map
Principal Investigator:
Guy Caldwell
Terms and Licenses:
MTA

Comments:

Gateway-modified yeast two-hybrid DNA-binding domain vector. Use this vector for Gateway cloning of a cDNA to be used as the bait in a yeast two-hybrid screen. This vector was modified from plasmid pLexA by placing a Gateway acceptor cassette in the SmaI site of pLexA. To facilitate subcloning of a given DNA insert into this plasmid, Gateway recombinational attachment sites should be incorporated into primers used for amplificiation, as outlined in the Invitrogen Gateway manual. Gateway recombinational cassettes should be added to primers as outlined in the Invitrogen Gateway manual. (Gateway is a registered trademark of Invitrogen Corporation). Please note that the "author's map" is the map of the original pLexA vector upon which pLexAgtwy is derived - it is not a map of pLexAgtwy.

This plasmid is intended for use exclusively as a teaching resource as part of the Integrated Genomics Discovery-Based Laboratory Course. Addgene does not make any guarantee that the plasmid is suitable for research purposes.

Addgene has sequenced a portion of this plasmid for verification. Click here for the sequencing result.

Please acknowledge the principal investigator and cite this article if you use this plasmid in a publication. Also, please include the text "Addgene plasmid 11345" in your Materials and Methods section.