pLexA::Ras
(Plasmid #11340)

• Depositing Lab: Michael Wigler
• Publication: Chang et al Cell. 1994 Oct 7. 79(1):131-41.

Backbone

• Vector backbone: pLexA
• Backbone manufacturer: see pLexA map in "author's map"
• Backbone size w/o insert (bp): 5700
• Vector type: Yeast Expression
• Selectable markers: TRP1

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: Ras1
• Alt name: Ras-1
• Species: S. pombe (fission yeast)
• Insert Size (bp): 660
• Entrez Gene: ras1 (a.k.a. SPAC17H9.09c, ste5)
• Tag / Fusion Protein:
  • LexA DNA binding domain (N terminal on backbone)

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ sequencing primer: LexA sequencing primer (CGTCAGCAGAGCTTCACCATTG)

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

Depositor Comments

cDNA of fission yeast S. pombe Ras1 gene (oncogene) cloned into the yeast two-hybrid DNA-binding domain vector pLexA (ref., Chang et al., 2004, Cell, 79:131-141). See "author's map" for picture of empty pLexA vector.