1
Plasmid 11340: pLexA::Ras
  • Ras1

  • Ras-1

  • 660

  • S. pombe (fission yeast)

  • ras1 ()

  • LexA DNA binding domain

  • N terminal on backbone

  • pLexA
    (Search Vector Database)

  • see pLexA map in "author's map"

  • Yeast Expression

  • 5700

  • LexA sequencing primer (CGTCAGCAGAGCTTCACCATTG) List of Sequencing Primers

  • Ampicillin

  • DH5alpha

  • 37

  • High Copy

  • TRP1

  • View sequences (1)
  • View map

  • Michael Wigler

  • MTA

Comments: 

cDNA of fission yeast S. pombe Ras1 gene (oncogene) cloned into the yeast two-hybrid DNA-binding domain vector pLexA (ref., Chang et al., 2004, Cell, 79:131-141). See "author's map" for picture of empty pLexA vector.

Addgene has sequenced a portion of this plasmid for verification. Click here for the sequencing result.

Article: Cooperative interaction of S. pombe proteins required for mating and morphogenesis. Chang et al (Cell. 1994 Oct 7. 79(1):131-41. PubMed)

Please acknowledge the principal investigator and cite this article if you use this plasmid in a publication. Also, please include the text "Addgene plasmid 11340" in your Materials and Methods section.