pcDNA3.1 myc-NL-GW
(Plasmid
#113446)
-
Purpose(Empty Backbone) NanoLuc Gateway shuttle vector for N-terminal fusions
-
Depositing Lab
-
Publication
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | ||
---|---|---|---|---|---|---|
Plasmid | 113446 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $75 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonepcDNA3.1
- Backbone size (bp) 5428
-
Vector typeMammalian Expression, Luciferase ; Gateway shuttle vector
- Promoter CMV
-
Selectable markersNeomycin (select with G418)
-
Tag
/ Fusion Protein
- cmyc-NanoLuc (N terminal on insert)
Growth in Bacteria
-
Bacterial Resistance(s)Chloramphenicol and Ampicillin
-
Growth Temperature37°C
-
Growth Strain(s)ccdB Survival
-
Copy numberHigh Copy
Cloning Information
- Cloning method Gateway Cloning
- 5′ sequencing primer GAACGGCAACAAAATTATCGAC
- 3′ sequencing primer TAGAAGGCACAGTCGAGGCT (Common Sequencing Primers)
Resource Information
-
Terms and Licenses
-
Industry Terms
- Not Available to Industry
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pcDNA3.1 myc-NL-GW was a gift from Erich Wanker (Addgene plasmid # 113446 ; http://n2t.net/addgene:113446 ; RRID:Addgene_113446) -
For your References section:
LuTHy: a double‐readout bioluminescence‐based two‐hybrid technology for quantitative mapping of protein–protein interactions in mammalian cells. Trepte P, Kruse S, Kostova S, Hoffmann S, Buntru A, Tempelmeier A, Secker C, Diez L, Schulz A, Klockmeier K, Zenkner M, Golusik S, Rau K, Schnoegl S, Garner CC, Wanker EE.. Molecular Systems Biology (2018) 14, e8071 10.15252/msb.20178071