Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Addgene is open for ordering and depositing; find up-to-date details here. To learn more about how we are supporting COVID-19 research and to find related plasmids, check out our COVID-19 and Coronavirus Plasmids & Resources page.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected] Learn more

pcDNA3.1 PA-mCit-GW
(Plasmid #113448)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 113448 Standard format: Plasmid sent in bacteria as agar stab 1 $75

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    pcDNA3.1
  • Backbone size (bp) 5428
  • Vector type
    Mammalian Expression ; Gateway shuttle vector
  • Promoter CMV
  • Selectable markers
    Neomycin (select with G418)
  • Tag / Fusion Protein
    • ProteinA-mCitrine (N terminal on insert)

Growth in Bacteria

  • Bacterial Resistance(s)
    Chloramphenicol and Ampicillin
  • Growth Temperature
    37°C
  • Growth Strain(s)
    ccdB Survival
  • Copy number
    High Copy

Cloning Information

  • Cloning method Gateway Cloning
  • 5′ sequencing primer AGCAGAATACGCCCATCG
  • 3′ sequencing primer TAGAAGGCACAGTCGAGGCT
  • (Common Sequencing Primers)

Resource Information

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pcDNA3.1 PA-mCit-GW was a gift from Erich Wanker (Addgene plasmid # 113448 ; http://n2t.net/addgene:113448 ; RRID:Addgene_113448)
  • For your References section:

    LuTHy: a double‐readout bioluminescence‐based two‐hybrid technology for quantitative mapping of protein–protein interactions in mammalian cells. Trepte P, Kruse S, Kostova S, Hoffmann S, Buntru A, Tempelmeier A, Secker C, Diez L, Schulz A, Klockmeier K, Zenkner M, Golusik S, Rau K, Schnoegl S, Garner CC, Wanker EE.. Molecular Systems Biology (2018) 14, e8071 10.15252/msb.20178071