Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Addgene is open for ordering and depositing; find up-to-date details here. To learn more about how we are supporting COVID-19 research and to find related plasmids, check out our COVID-19 and Coronavirus Plasmids & Resources page.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected] Learn more

pLenti PA-NL
(Plasmid #113453)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 113453 Standard format: Plasmid sent in bacteria as agar stab 1 $75

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    FUGW
  • Backbone manufacturer
    FUGW was a gift from David Baltimore (Addgene plasmid # 14883)
  • Total vector size (bp) 10311
  • Vector type
    Mammalian Expression, Lentiviral, Luciferase

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    ProteinA-NanoLuc
  • Insert Size (bp)
    921
  • Promoter hUbC

Cloning Information

  • Cloning method Unknown
  • 5′ sequencing primer tgaagctccggttttgaact
  • 3′ sequencing primer ggcattaaagcagcgtatcc
  • (Common Sequencing Primers)

Resource Information

  • A portion of this plasmid was derived from a plasmid made by
    Viral Core Facility (VCF) of the Charité – Universitätsmedizin Berlin
  • Terms and Licenses
  • Industry Terms
    • Not Available to Industry
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pLenti PA-NL was a gift from Erich Wanker (Addgene plasmid # 113453 ; http://n2t.net/addgene:113453 ; RRID:Addgene_113453)
  • For your References section:

    LuTHy: a double‐readout bioluminescence‐based two‐hybrid technology for quantitative mapping of protein–protein interactions in mammalian cells. Trepte P, Kruse S, Kostova S, Hoffmann S, Buntru A, Tempelmeier A, Secker C, Diez L, Schulz A, Klockmeier K, Zenkner M, Golusik S, Rau K, Schnoegl S, Garner CC, Wanker EE.. Molecular Systems Biology (2018) 14, e8071 10.15252/msb.20178071