pLenti6.2_mTurquoise2
(Plasmid
#113723)
-
PurposeExpresses the fluorescent protein mTurquoise2 in a lentiviral backbone
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 113723 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonepLenti6.2
- Backbone size w/o insert (bp) 7892
- Total vector size (bp) 8612
-
Vector typeMammalian Expression, Lentiviral
-
Selectable markersPuromycin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert namemTurquoise2
-
Alt namemTq2
-
SpeciesSynthetic
-
Insert Size (bp)720
- Promoter CMV
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site XbaI (not destroyed)
- 3′ cloning site SalI (not destroyed)
- 5′ sequencing primer CGCAAATGGGCGGTAGGCGTG
- 3′ sequencing primer CATAGCGTAAAAGGAGCAACA (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
-
A portion of this plasmid was derived from a plasmid made byThe pLenti6.2 backbone and ORF was isolated from the vector #17448 and #98837 respectively bought from Addgene. Both parts were excised from their original plasmids and recloned resulting in the current plasmid. In addition a few additional RE sites were introduced at the 5` end of the ORF generating a small multiple cloning site was inserted that can be used to create fusion proteins.
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pLenti6.2_mTurquoise2 was a gift from Vanessa LaPointe (Addgene plasmid # 113723 ; http://n2t.net/addgene:113723 ; RRID:Addgene_113723)