Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected] Learn more

pLenti6.2_miRFP670
(Plasmid #113726)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 113726 Standard format: Plasmid sent in bacteria as agar stab 1 $75

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    pLenti6.2
  • Backbone size w/o insert (bp) 7909
  • Total vector size (bp) 8857
  • Vector type
    Mammalian Expression, Lentiviral
  • Selectable markers
    Puromycin

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    miRFP670
  • Species
    Synthetic
  • Insert Size (bp)
    948
  • Promoter CMV

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site XbaI (not destroyed)
  • 3′ cloning site MluI (not destroyed)
  • 5′ sequencing primer CGCAAATGGGCGGTAGGCGTG
  • 3′ sequencing primer CATAGCGTAAAAGGAGCAACA
  • (Common Sequencing Primers)

Resource Information

  • Supplemental Documents
  • A portion of this plasmid was derived from a plasmid made by
    The pLenti6.2 backbone and ORF was isolated from the vector #17448 and #79987 respectively bought from Addgene. Both parts were excised from their original plasmids and recloned resulting in the current plasmid. In addition a few additional RE sites were introduced at the 5` end of the ORF generating a small multiple cloning site was inserted that can be used to create fusion proteins.

Terms and Licenses

Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pLenti6.2_miRFP670 was a gift from Vanessa LaPointe (Addgene plasmid # 113726 ; http://n2t.net/addgene:113726 ; RRID:Addgene_113726)