Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected] Learn more

(Plasmid #115790)


Item Catalog # Description Quantity Price (USD)
Plasmid 115790 Standard format: Plasmid sent in bacteria as agar stab 1 $75

This material is available to academics and nonprofits only.


  • Vector backbone
  • Backbone size w/o insert (bp) 3462
  • Total vector size (bp) 7194
  • Modifications to backbone
    Removed RelA(p65) AND Rta AD domains from fusion
  • Vector type
    Mammalian Expression, AAV
  • Selectable markers

Growth in Bacteria

  • Bacterial Resistance(s)
  • Growth Temperature
  • Growth Strain(s)
    NEB Stable
  • Copy number
    High Copy


  • Gene/Insert name
  • Species
    S. aureus
  • Promoter CMV
  • Tag / Fusion Protein
    • VP64 (C terminal on insert)

Cloning Information

  • Cloning method Gibson Cloning
  • 5′ sequencing primer GTCGTAACAACTCCGCCCCATTGA
  • 3′ sequencing primer CAACAGATGGCTGGCAACTAGAAG
  • (Common Sequencing Primers)

Resource Information

  • A portion of this plasmid was derived from a plasmid made by
    Addgene plasmid: 68495
  • Terms and Licenses
  • Industry Terms
    • Not Available to Industry
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pCMV-sadCas9-VP64 was a gift from Nadav Ahituv (Addgene plasmid # 115790 ; ; RRID:Addgene_115790)
  • For your References section:

    CRISPR-mediated activation of a promoter or enhancer rescues obesity caused by haploinsufficiency. Matharu N, Rattanasopha S, Tamura S, Maliskova L, Wang Y, Bernard A, Hardin A, Eckalbar WL, Vaisse C, Ahituv N. Science. 2018 Dec 13. pii: science.aau0629. doi: 10.1126/science.aau0629. 10.1126/science.aau0629 PubMed 30545847