CAG-GCaMP6f-3x-miR204-5p-3x-miR122-TS
(Plasmid
#117384)
-
PurposeAn AAV genome containing miRNA target sequences (TS) 204-5p and 122 to reduce expression of GCaMP6f in astrocytes and hepatocytes, respectively
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 117384 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonepAAV
- Backbone size w/o insert (bp) 5352
- Total vector size (bp) 6000
-
Vector typeMammalian Expression, AAV
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameGCaMP6f + 3 copies of miR204 : AGGCATAGGATGACAAAGGGAA ; 3 copies of miR122 : CAAACACCATTGTCACACTCCA
-
SpeciesSynthetic
-
Insert Size (bp)1353
- Promoter CAG
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site atgggttctcatcatc (unknown if destroyed)
- 3′ cloning site tgatgacagcgaagtga (unknown if destroyed)
- 5′ sequencing primer pCAG-F
- 3′ sequencing primer WPRE-R (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
CAG-GCaMP6f-3x-miR204-5p-3x-miR122-TS was a gift from Viviana Gradinaru (Addgene plasmid # 117384 ; http://n2t.net/addgene:117384 ; RRID:Addgene_117384) -
For your References section:
Systemic AAV vectors for widespread and targeted gene delivery in rodents. Challis RC, Ravindra Kumar S, Chan KY, Challis C, Beadle K, Jang MJ, Kim HM, Rajendran PS, Tompkins JD, Shivkumar K, Deverman BE, Gradinaru V. Nat Protoc. 2019 Feb;14(2):379-414. doi: 10.1038/s41596-018-0097-3. 10.1038/s41596-018-0097-3 PubMed 30626963