Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

pAAV-camk2-Sthk-p2a-bpac(WT) minWPRE
(Plasmid #118274)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 118274 Standard format: Plasmid sent in bacteria as agar stab 1 $85

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    CW3SL
  • Backbone manufacturer
    Bong-Kiun Kaang
  • Backbone size w/o insert (bp) 3771
  • Total vector size (bp) 7002
  • Vector type
    Mammalian Expression, AAV

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    XL10 Gold
  • Copy number
    Unknown

Gene/Insert 1

  • Gene/Insert name
    bPAC(WT)
  • Alt name
    photoactivated adenylyl cyclase from Beggiatoa sp.
  • Species
    Beggiatoa sp.
  • Insert Size (bp)
    1055
  • GenBank ID
  • Promoter CamK II
  • Tags / Fusion Proteins
    • myc tag (C terminal on insert)
    • His tag (C terminal on insert)
    • mCherry (C terminal on insert)

Cloning Information for Gene/Insert 1

  • Cloning method Gibson Cloning
  • 5′ sequencing primer CGGAGCTACTAACTTCAGCC
  • 3′ sequencing primer CGTATCCACATAGCGTAAAAGGAGCAA
  • (Common Sequencing Primers)

Gene/Insert 2

  • Gene/Insert name
    SthK
  • Species
    Spirochaeta thermophila
  • GenBank ID
    YP_003873862.1
  • Promoter CamK II
  • Tag / Fusion Protein
    • P2A (C terminal on insert)

Cloning Information for Gene/Insert 2

  • Cloning method Gibson Cloning
  • 5′ sequencing primer GTTCTCCGTTTGCACTCAGGA
  • 3′ sequencing primer GGGTTCTCCTCCACGTCTC
  • (Common Sequencing Primers)

Terms and Licenses

Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pAAV-camk2-Sthk-p2a-bpac(WT) minWPRE was a gift from Dietmar Schmitz (Addgene plasmid # 118274 ; http://n2t.net/addgene:118274 ; RRID:Addgene_118274)
  • For your References section:

    Potassium channel-based optogenetic silencing. Bernal Sierra YA, Rost BR, Pofahl M, Fernandes AM, Kopton RA, Moser S, Holtkamp D, Masala N, Beed P, Tukker JJ, Oldani S, Bonigk W, Kohl P, Baier H, Schneider-Warme F, Hegemann P, Beck H, Seifert R, Schmitz D. Nat Commun. 2018 Nov 5;9(1):4611. doi: 10.1038/s41467-018-07038-8. 10.1038/s41467-018-07038-8 PubMed 30397200