Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected] Learn more

pLenti CMV GFP Hygro (656-4)
(Plasmid #17446)


Item Catalog # Description Quantity Price (USD)
Plasmid 17446 Standard format: Plasmid sent in bacteria as agar stab 1 $65
Concentrated Lentiviral Prep 17446-LVC Virus (50 µL at titer ≥ 1×10⁷ TU/mL) and Plasmid. More Information

This material is available to academics and nonprofits only.


  • Vector backbone
    p156RRL-sinPPT-CMV-GFP-PRE/Nhe I
  • Backbone size w/o insert (bp) 8591
  • Vector type
    Mammalian Expression, Lentiviral
  • Selectable markers

Growth in Bacteria

  • Bacterial Resistance(s)
  • Growth Temperature
  • Growth Strain(s)
  • Growth instructions
    Stbl3, 37oC
  • Copy number
    High Copy


  • Gene/Insert name
  • Alt name
    enhanced GFP
  • Insert Size (bp)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site BamHI (not destroyed)
  • 3′ cloning site Sal I (not destroyed)
  • 5′ sequencing primer CMVforw
  • (Common Sequencing Primers)

Resource Information

Information for Concentrated Lentiviral Prep (Catalog # 17446-LVC) ( Back to top )


Ready-to-use Concentrated Lentiviral Prep particles produced from pLenti CMV GFP Hygro (656-4) (#17446). In addition to the viral particles, you will also receive purified pLenti CMV GFP Hygro (656-4) plasmid DNA.

Concentrated lentiviral particles carrying the GFP and hygromcyin resistance.


  • Volume 50 µL
  • Titer ≥1×10⁷ TU/mL
  • Pricing $150 USD for preparation of 50 µL virus + $30 USD for plasmid.
  • Storage Store at -80℃. Thaw just before use and keep on ice.
  • Shipment Viral particles are shipped frozen on dry ice. Plasmid DNA (≥ 200ng) will also be included in the shipment.

Viral Production & Use

  • Packaging Plasmids psPAX2 (plasmid #12260)
  • Envelope pMD2.G (plasmid #12259)
  • Buffer Opti-Pro SFM
  • Selectable Marker Hygromycin
  • Purification Lentivirus was harvested from cell culture medium (DMEM + 10% FBS). Lentiviral particles were then collected by precipitation in polyethylene glycol (PEG) followed by centrifugation. Precipitated pellets containing viral particles were resuspended in PBS.


Requestor is responsible for compliance with their institution's biosafety regulations. Lentivirus is generally considered BSL-2. AAV is generally considered BSL-1, but may require BSL-2 handling depending on the insert. Biosafety Guide

Resource Information

Viral Quality Control

Titering Method:
  • PCR confirmation of insert: PCR was carried out with primers targeting the CMV promoter and WPRE. The PCR product was visualized on an agarose gel for size confirmation.
    Forward Primer: Hygro-internal-F GCGCCGATGGTTTCTACAAA

Visit our viral production page for more information.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pLenti CMV GFP Hygro (656-4) was a gift from Eric Campeau & Paul Kaufman (Addgene plasmid # 17446 ; ; RRID:Addgene_17446)

    For viral preps, please replace (Addgene plasmid # 17446) in the above sentence with: (Addgene viral prep # 17446-LVC)

  • For your References section:

    A versatile viral system for expression and depletion of proteins in mammalian cells. Campeau E, Ruhl VE, Rodier F, Smith CL, Rahmberg BL, Fuss JO, Campisi J, Yaswen P, Cooper PK, Kaufman PD.. PLoS One. 2009 Aug 6;4(8):e6529. 10.1371/journal.pone.0006529 PubMed 19657394