pLenti CMV GFP Hygro (656-4)
(Plasmid #17446)

• Purpose: 3rd gen lentiviral eGFP expression vector, CMV promoter, Hygro
• Depositing Labs: Eric Campeau, Paul Kaufman
• Publication: Campeau et al PLoS One. 2009 Aug 6;4(8):e6529.

Ordering

Item	Catalog #	Description	Quantity	Price (USD)
Plasmid	17446	Standard format: Plasmid sent in bacteria as agar stab	1	$75	Add to Cart
Concentrated Lentiviral Prep	17446-LVC	Virus (50 µL at titer ≥ 1×10⁷ TU/mL) and Plasmid. More Information	1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30	$180	Add to Cart

This material is available to academics and nonprofits only.

Backbone

• Vector backbone: p156RRL-sinPPT-CMV-GFP-PRE/Nhe I
  (Search Vector Database)
• Backbone size w/o insert (bp): 8591
• Vector type: Mammalian Expression, Lentiviral
• Selectable markers: Hygromycin

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin
• Growth Temperature: 37°C
• Growth Strain(s): Stbl3
• Growth instructions: Stbl3, 37oC
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: GFP
• Alt name: enhanced GFP
• Insert Size (bp): 719

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: BamHI (not destroyed)
• 3′ cloning site: Sal I (not destroyed)
• 5′ sequencing primer: CMVforw

Resource Information

• Addgene Notes:
  • Addgene diagnostic digest
• Terms and Licenses:
  • UBMTA
  • Ancillary Agreement for Plasmids Containing FP Materials
• Industry Terms:
  • Not Available to Industry
• Articles Citing this Plasmid:
  • 8 References

Information for Concentrated Lentiviral Prep (Catalog # 17446-LVC)

Purpose

Ready-to-use Concentrated Lentiviral Prep particles produced from pLenti CMV GFP Hygro (656-4) (#17446). In addition to the viral particles, you will also receive purified pLenti CMV GFP Hygro (656-4) plasmid DNA.

Concentrated lentiviral particles carrying the GFP and hygromcyin resistance.

Delivery

• Volume: 50 µL
• Titer: ≥1×10⁷ TU/mL
• Pricing: $150 USD for preparation of 50 µL virus + $30 USD for plasmid.
• Storage: Store at -80℃. Thaw just before use and keep on ice.
• Shipment: Viral particles are shipped frozen on dry ice. Plasmid DNA (≥ 200ng) will also be included in the shipment.

Viral Production & Use

• Packaging Plasmids: psPAX2 (plasmid #12260)
• Envelope: pMD2.G (plasmid #12259)
• Buffer: Opti-Pro SFM
• Selectable Marker: Hygromycin
• Purification: Lentivirus was harvested from cell culture medium (DMEM + 10% FBS). Lentiviral particles were then collected by precipitation in polyethylene glycol (PEG) followed by centrifugation. Precipitated pellets containing viral particles were resuspended in PBS.

Biosafety

Requestor is responsible for compliance with their institution's biosafety regulations. Lentivirus is generally considered BSL-2. AAV is generally considered BSL-1, but may require BSL-2 handling depending on the insert. Biosafety Guide

Resource Information

• Terms and Licenses:
  • Terms of Use for Viral Vectors
• Industry Terms:
  • Not Available to Industry

Viral Quality Control

Titering Method:

• Direct fluorescence: Lenti-X cells were transduced with serial dilutions of 17446-LVC. 96 hours later, GFP-positive cells were counted. You can view GFP expression in 17446-LVC-transduced cells here or at the image section at the top of this page. Read our fluorescence titering assay protocol here.

Notes:

• PCR confirmation of insert: PCR was carried out with primers targeting the CMV promoter and WPRE. The PCR product was visualized on an agarose gel for size confirmation.
  Forward Primer: Hygro-internal-F GCGCCGATGGTTTCTACAAA
  Reverse Primer: SV40pA-R GAAATTTGTGATGCTATTGC

Visit our viral production page for more information.