-
Purpose3rd gen lentiviral eGFP expression vector, CMV promoter, Hygro
-
Depositing Labs
-
Publication
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | ||
---|---|---|---|---|---|---|
Plasmid | 17446 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $65 | ||
Concentrated Lentiviral Prep | 17446-LVC |
Limited Stock Available, 4 units left Virus (50 µL at titer ≥ 1×10⁷ TU/mL) |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonep156RRL-sinPPT-CMV-GFP-PRE/Nhe I
- Backbone size w/o insert (bp) 8591
-
Vector typeMammalian Expression, Lentiviral
-
Selectable markersHygromycin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin
-
Growth Temperature37°C
-
Growth Strain(s)Stbl3
-
Growth instructionsStbl3, 37oC
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameGFP
-
Alt nameenhanced GFP
-
Insert Size (bp)719
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site BamHI (not destroyed)
- 3′ cloning site Sal I (not destroyed)
- 5′ sequencing primer CMVforw (Common Sequencing Primers)
Resource Information
-
Addgene Notes
-
Terms and Licenses
-
Articles Citing this Plasmid
Information for Concentrated Lentiviral Prep (Catalog # 17446-LVC) ( Back to top )
Purpose
Ready-to-use Concentrated Lentiviral Prep particles produced from pLenti CMV GFP Hygro (656-4) (#17446). In addition to the viral particles, you will also receive purified pLenti CMV GFP Hygro (656-4) plasmid DNA.
Concentrated lentiviral particles carrying the GFP and hygromcyin resistance.Delivery
- Volume 50 µL
- Titer ≥1×10⁷ TU/mL
- Pricing $150 USD for preparation of 50 µL virus + $30 USD for plasmid.
- Storage Store at -80℃. Thaw just before use and keep on ice.
- Shipment Viral particles are shipped frozen on dry ice. Plasmid DNA (≥ 200ng) will also be included in the shipment.
Viral Production & Use
- Packaging Plasmids psPAX2 (plasmid #12260)
- Envelope pMD2.G (plasmid #12259)
- Buffer Opti-Pro SFM
- Selectable Marker Hygromycin
- Purification Lentivirus was harvested from cell culture medium (DMEM + 10% FBS). Lentiviral particles were then collected by precipitation in polyethylene glycol (PEG) followed by centrifugation. Precipitated pellets containing viral particles were resuspended in PBS.
Biosafety
Requestor is responsible for compliance with their institution's biosafety regulations. Lentivirus is generally considered BSL-2. AAV is generally considered BSL-1, but may require BSL-2 handling depending on the insert. Biosafety Guide
Resource Information
-
Terms and Licenses
Viral Quality Control
- Direct fluorescence: Lenti-X cells were transduced with serial dilutions of 17446-LVC. 96 hours later, GFP-positive cells were counted. You can view GFP expression in 17446-LVC-transduced cells here or at the image section at the top of this page. Read our fluorescence titering assay protocol here.
- PCR confirmation of insert: PCR was carried out with primers targeting the CMV promoter and WPRE. The PCR product was visualized on an agarose gel for size confirmation.
Forward Primer: Hygro-internal-F GCGCCGATGGTTTCTACAAA
Reverse Primer: SV40pA-R GAAATTTGTGATGCTATTGC
Visit our viral production page for more information.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pLenti CMV GFP Hygro (656-4) was a gift from Eric Campeau & Paul Kaufman (Addgene plasmid # 17446 ; http://n2t.net/addgene:17446 ; RRID:Addgene_17446)
For viral preps, please replace (Addgene plasmid # 17446) in the above sentence with: (Addgene viral prep # 17446-LVC)
-
For your References section:
A versatile viral system for expression and depletion of proteins in mammalian cells. Campeau E, Ruhl VE, Rodier F, Smith CL, Rahmberg BL, Fuss JO, Campisi J, Yaswen P, Cooper PK, Kaufman PD.. PLoS One. 2009 Aug 6;4(8):e6529. 10.1371/journal.pone.0006529 PubMed 19657394