Skip to main content
Holiday Schedule: Addgene will be closed November 26th & 27th for the Thanksgiving Holiday. Order processing and shipping may be delayed during this week. For questions about your shipment please contact [email protected].
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected] Learn more

pMSCVpuro-DEST
(Plasmid #119745)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 119745 Standard format: Plasmid sent in bacteria as agar stab 1 $75

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    pMSCVpuro
  • Backbone manufacturer
    Clontech
  • Backbone size (bp) 6300
  • Modifications to backbone
    RfB Gateway cassette cloned into pMSCVpuro HpaI site
  • Vector type
    Mammalian Expression, Retroviral
  • Selectable markers
    Puromycin

Growth in Bacteria

  • Bacterial Resistance(s)
    Chloramphenicol and Ampicillin
  • Growth Temperature
    37°C
  • Growth Strain(s)
    ccdB Survival
  • Copy number
    High Copy

Cloning Information

  • Cloning method Gateway Cloning
  • 5′ sequencing primer pMSCV-5' - CCCTTGAACCTCCTCGTTCGACC
  • 3′ sequencing primer pMSCV-3' - GAGACGTGCTACTTCCATTTGTC
  • (Common Sequencing Primers)

Resource Information

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pMSCVpuro-DEST was a gift from Andrew Jackson & Martin Reijns (Addgene plasmid # 119745 ; http://n2t.net/addgene:119745 ; RRID:Addgene_119745)
  • For your References section:

    RNase H2, mutated in Aicardi-Goutieres syndrome, promotes LINE-1 retrotransposition. Benitez-Guijarro M, Lopez-Ruiz C, Tarnauskaite Z, Murina O, Mian Mohammad M, Williams TC, Fluteau A, Sanchez L, Vilar-Astasio R, Garcia-Canadas M, Cano D, Kempen MH, Sanchez-Pozo A, Heras SR, Jackson AP, Reijns MA, Garcia-Perez JL. EMBO J. 2018 Aug 1;37(15). pii: embj.201798506. doi: 10.15252/embj.201798506. Epub 2018 Jun 29. 10.15252/embj.201798506 PubMed 29959219