1
Plasmid 12019: pAG192 PIK3CG 3'UTR
  • N23 3'UTR

  • PIK3CG

  • 600

  • H. sapiens (human)

  • NM_002649

  • PIK3CG (PI3CG, PI3K, PI3Kgamma, PIK3)

  • pIS2
    (Search Vector Database)

  • pIS2 derived from pRL-SV40 (Promega)

  • Mammalian Expression, Luciferase

  • 3700

  • SacI

  • No

  • SpeI

  • No

  • EBV rev primer (GTGGTTTGTCCAAACTCATC) List of Sequencing Primers

  • Ampicillin

  • DH5alpha

  • 37

  • High Copy

  • View sequences (2)
  • David Bartel

  • MTA
    Luciferase Limited Use Label License

Comments: 

PIK3CG 3'UTR in renilla luciferase reporter plasmid.

Addgene has sequenced a portion of this plasmid for verification. Click here for the sequencing result.

Article: The widespread impact of mammalian MicroRNAs on mRNA repression and evolution. Farh et al (Science. 2005 Dec 16. 310(5755):1817-21. PubMed)

Please acknowledge the principal investigator and cite this article if you use this plasmid in a publication. Also, please include the text "Addgene plasmid 12019" in your Materials and Methods section.

Price: $65.00

Available to academic and non-profits only