Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

K9L mutant of H3K9me3 biosensor
(Plasmid #120807)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 120807 Standard format: Plasmid sent in bacteria as agar stab 1 $85

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    pCAGGS vector
  • Backbone size w/o insert (bp) 4717
  • Total vector size (bp) 7021
  • Modifications to backbone
    one BsaI site was mutated for Golden Gate Assembly purpose
  • Vector type
    Mammalian Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    Truncated YPet-HP1-EV linker-ECFP-mouse histone H3(K9L mutation)
  • Species
    M. musculus (mouse), D. melanogaster (fly), Synthetic
  • Insert Size (bp)
    2304
  • Mutation
    lysine 9 is mutated to leucine 9 on histone H3
  • Promoter CMV

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site EcoRI (not destroyed)
  • 3′ cloning site SalI (not destroyed)
  • 5′ sequencing primer GCCTCTGCTAACCATGTTCATGCC
  • 3′ sequencing primer CAGATGCTCAAGGGGCTTCATG
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    K9L mutant of H3K9me3 biosensor was a gift from Yingxiao Wang (Addgene plasmid # 120807 ; http://n2t.net/addgene:120807 ; RRID:Addgene_120807)
  • For your References section:

    Coordinated histone modifications and chromatin reorganization in a single cell revealed by FRET biosensors. Peng Q, Lu S, Shi Y, Pan Y, Limsakul P, Chernov AV, Qiu J, Chai X, Shi Y, Wang P, Ji Y, Li YJ, Strongin AY, Verkhusha VV, Izpisua Belmonte JC, Ren B, Wang Y, Chien S, Wang Y. Proc Natl Acad Sci U S A. 2018 Nov 26. pii: 1811818115. doi: 10.1073/pnas.1811818115. 10.1073/pnas.1811818115 PubMed 30478057