-
Depositing Lab
-
Publication
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 12148 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonepCMV5
- Backbone size w/o insert (bp) 4700
-
Vector typeMammalian Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameFoxo1
-
Alt nameFkhr
-
Alt nameforkhead box O1
-
SpeciesM. musculus (mouse)
-
Insert Size (bp)2000
-
GenBank IDNM_019739
-
Entrez GeneFoxo1 (a.k.a. Afxh, FKHR, Fkhr1, Foxo1a)
- Promoter CMV
-
Tags
/ Fusion Proteins
- Myc (N terminal on backbone)
- FLAG (N terminal on insert)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site KpnI (not destroyed)
- 3′ cloning site XbaI (not destroyed)
- 5′ sequencing primer CMV-F; pCEP-F
- 3′ sequencing primer hGH-pA-R (CCAGCTTGGTTCCCAATAGA) (Common Sequencing Primers)
Resource Information
-
Addgene Notes
-
Articles Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Note that a BLAST search with Addgene's quality control sequence shows a K219R mutation. The Accili lab has explained that this is a common variant and they do not consider it a mutation at all. They have used the plasmid routinely without issue. The plasmid also contains an L619P polymorphism.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
FLAG-Foxo1(pCMV5) was a gift from Domenico Accili (Addgene plasmid # 12148 ; http://n2t.net/addgene:12148 ; RRID:Addgene_12148) -
For your References section:
FoxO1 protects against pancreatic beta cell failure through NeuroD and MafA induction. Kitamura YI, Kitamura T, Kruse JP, Raum JC, Stein R, Gu W, Accili D. Cell Metab. 2005 Sep . 2(3):153-63. 10.1016/j.cmet.2005.08.004 PubMed 16154098