1
Plasmid 17560: FLAG-Foxo1-WT 6KR
  • Foxo1 6KR

  • Foxo1

  • Fkhr

  • forkhead box O1

  • 1700

  • M. musculus (mouse)

  • Foxo1 (AI876417, Afxh, FKHR, Fkhr1, Foxo1a)

  • Myc

  • N terminal on backbone

  • Flag

  • N terminal on insert

  • K242, K245, K259, K262, K271 and K291 were replaced with arginine.

  • pCMV5
    (Search Vector Database)

  • Mammalian Expression

  • 4700

  • CMV

  • KpnI

  • No

  • XbaI

  • No

  • CMV-F; pCEP-F List of Sequencing Primers

  • hGH-pA-R (CCAGCTTGGTTCCCAATAGA)

  • Ampicillin

  • DH5alpha

  • 37

  • Unknown

  • View sequences (3)
  • Domenico Accili

  • UBMTA

Comments: 

Plasmid has K219R and L619P polymorphisms which are not thought to affect plasmid function.

Addgene has sequenced a portion of this plasmid for verification. Full plasmid sequence is available only if provided by the depositing laboratory.

Article: FoxO1 protects against pancreatic beta cell failure through NeuroD and MafA induction. Kitamura et al (Cell Metab. 2005 Sep . 2(3):153-63. PubMed)

Please acknowledge the principal investigator and cite this article if you use this plasmid in a publication. Also, please include the text "Addgene plasmid 17560" in your Materials and Methods section.