pOTTC1484 - pAAV SYN1 HA-hM4D(Gi)
(Plasmid #121538)

• Purpose: An adeno-associated viral vector expressing HA-tagged inhibitory DREADD (hM4D(Gi)) from a synapsin promoter
• Depositing Lab: Christopher Richie
• Publication: Galvan et al Eur J Neurosci. 2019 May 7. doi: 10.1111/ejn.14429.

Backbone

• Vector backbone: pOTTC1479 - pAAV SYN1 iRFP-FLAG
• Backbone manufacturer: NIDA_GEVVC
• Backbone size w/o insert (bp): 4500
• Total vector size (bp): 5571
• Vector type: Mammalian Expression, AAV

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 30°C
• Growth Strain(s): NEB Stable
• Copy number: Low Copy

Gene/Insert

• Gene/Insert name: HA-tagged hM4D(Gi)
• Species: H. sapiens (human)
• Insert Size (bp): 1470
• GenBank ID: 1132 CHRM4
• Entrez Gene: CHRM4 (a.k.a. HM4, M4R)
• Promoter: SYN1
• Tag / Fusion Protein:
  • HA (N terminal on insert)

Cloning Information

• Cloning method: Ligation Independent Cloning
• 5′ sequencing primer: hSYN1 F417 ACTCAGCGCTGCCTCAGTCT
• 3′ sequencing primer: WPRE R1 ATGAAAGCCATACGGGAAGC

Resource Information

• Supplemental Documents:
  • pOTTC1484 - pAAV SYN1 HA-hM4D(Gi).ape.ape
• A portion of this plasmid was derived from a plasmid made by: Insert was amplified from pOTTC1329, Addgene 89150

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

Information for AAV2 (Catalog # 121538-AAV2)

Purpose

Ready-to-use AAV2 particles produced from pOTTC1484 - pAAV SYN1 HA-hM4D(Gi) (#121538). In addition to the viral particles, you will also receive purified pOTTC1484 - pAAV SYN1 HA-hM4D(Gi) plasmid DNA.

Synapsin-driven, HA-tagged hM4D(Gi) for neuronal inhibition. These AAV preparations are suitable purity for injection into animals.

Delivery

• Volume: 100 µL
• Titer: ≥ 7×10¹² vg/mL
• Pricing: $375 USD for preparation of 100 µL virus + $30 USD for plasmid.
• Storage: Store at -80℃. Thaw just before use and keep on ice.
• Shipment: Viral particles are shipped frozen on dry ice. Plasmid DNA (≥ 200ng) will also be included in the shipment.

Viral Production & Use

• Packaging Plasmids: encode adenoviral helper sequences and AAV rep gene, AAV2 cap gene
• Buffer: PBS + 0.001% Pluronic F-68 + 200 mM NaCl
• Serotype: AAV2
• Purification: Iodixanol gradient ultracentrifugation
• Reporter Gene: HA

Biosafety

Requestor is responsible for compliance with their institution's biosafety regulations. Lentivirus is generally considered BSL-2. AAV is generally considered BSL-1, but may require BSL-2 handling depending on the insert. Biosafety Guide

Terms and Licenses

• Academic/Nonprofit Terms:
  • Terms of Use for Viral Vectors
• Industry Terms:
  • Not Available to Industry

Viral Quality Control

Quality Control:

• Addgene ensures high quality viral vectors by optimizing and standardizing production protocols and performing rigorous quality control (QC) (see a list of our QC assays). The specific QC assays performed varies for each viral lot. To learn which specific QC assays were performed on your lot, please contact us.
• Titer: the exact titer of your sample will be reported on the tube. The titer you see listed on this page is the guaranteed minimum titer. See how titers are measured.

Visit our viral production page for more information.

Information for AAV5 (Catalog # 121538-AAV5)

Purpose

Ready-to-use AAV5 particles produced from pOTTC1484 - pAAV SYN1 HA-hM4D(Gi) (#121538). In addition to the viral particles, you will also receive purified pOTTC1484 - pAAV SYN1 HA-hM4D(Gi) plasmid DNA.

Synapsin-driven, HA-tagged hM4D(Gi) for neuronal inhibition. These AAV preparations are suitable purity for injection into animals.

Delivery

• Volume: 100 µL
• Titer: ≥ 7×10¹² vg/mL
• Pricing: $375 USD for preparation of 100 µL virus + $30 USD for plasmid.
• Storage: Store at -80℃. Thaw just before use and keep on ice.
• Shipment: Viral particles are shipped frozen on dry ice. Plasmid DNA (≥ 200ng) will also be included in the shipment.

Viral Production & Use

• Packaging Plasmids: encode adenoviral helper sequences and AAV rep gene, AAV5 cap gene
• Buffer: PBS + 0.001% Pluronic F-68 + 200 mM NaCl
• Serotype: AAV5
• Purification: Iodixanol gradient ultracentrifugation
• Reporter Gene: HA

Biosafety

Requestor is responsible for compliance with their institution's biosafety regulations. Lentivirus is generally considered BSL-2. AAV is generally considered BSL-1, but may require BSL-2 handling depending on the insert. Biosafety Guide

Terms and Licenses

• Academic/Nonprofit Terms:
  • Terms of Use for Viral Vectors
• Industry Terms:
  • Not Available to Industry

Viral Quality Control

Quality Control:

• Addgene ensures high quality viral vectors by optimizing and standardizing production protocols and performing rigorous quality control (QC) (see a list of our QC assays). The specific QC assays performed varies for each viral lot. To learn which specific QC assays were performed on your lot, please contact us.
• Titer: the exact titer of your sample will be reported on the tube. The titer you see listed on this page is the guaranteed minimum titer. See how titers are measured.

Visit our viral production page for more information.