Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected] Learn more

pOTTC1596 - pAAV SYN1 HA-hM3D(Gq)
(Plasmid #121539)


Item Catalog # Description Quantity Price (USD)
Plasmid 121539 Standard format: Plasmid sent in bacteria as agar stab 1 $75
AAV5 121539-AAV5 Virus (100 µL at titer ≥ 7×10¹² vg/mL) and Plasmid.

This material is available to academics and nonprofits only.


  • Vector backbone
    pOTTC1479 - pAAV SYN1 iRFP-FLAG
  • Backbone manufacturer
  • Backbone size w/o insert (bp) 4500
  • Total vector size (bp) 5571
  • Vector type
    Mammalian Expression, AAV

Growth in Bacteria

  • Bacterial Resistance(s)
  • Growth Temperature
  • Growth Strain(s)
    NEB Stable
  • Copy number
    Low Copy


  • Gene/Insert name
    HA-tagged hM3D(Gq)
  • Species
    H. sapiens (human)
  • Insert Size (bp)
  • GenBank ID
    1131 CHRM3
  • Entrez Gene
    CHRM3 (a.k.a. EGBRS, HM3, PBS)
  • Promoter SYN1
  • Tag / Fusion Protein
    • HA (N terminal on insert)

Cloning Information

  • Cloning method Ligation Independent Cloning
  • 5′ sequencing primer hSYN1 F417 ACTCAGCGCTGCCTCAGTCT
  • 3′ sequencing primer WPRE R1 ATGAAAGCCATACGGGAAGC
  • (Common Sequencing Primers)

Resource Information

  • Supplemental Documents
  • A portion of this plasmid was derived from a plasmid made by
    Insert was amplified from pOTTC1328, Addgene 89149
  • Terms and Licenses
  • Industry Terms
    • Not Available to Industry

Information for AAV5 (Catalog # 121539-AAV5) ( Back to top )


Ready-to-use AAV5 particles produced from pOTTC1596 - pAAV SYN1 HA-hM3D(Gq) (#121539). In addition to the viral particles, you will also receive purified pOTTC1596 - pAAV SYN1 HA-hM3D(Gq) plasmid DNA.

Synapsin-driven, HA-tagged hM3D(Gq) for neuronal activation. These AAV preparations are suitable purity for injection into animals.


  • Volume 100 µL
  • Titer ≥ 7×10¹² vg/mL
  • Pricing $350 USD for preparation of 100 µL virus + $30 USD for plasmid.
  • Storage Store at -80℃. Thaw just before use and keep on ice.
  • Shipment Viral particles are shipped frozen on dry ice. Plasmid DNA (≥ 200ng) will also be included in the shipment.

Viral Production & Use

  • Packaging Plasmids encode adenoviral helper sequences and AAV rep gene, AAV5 cap gene
  • Buffer PBS + 0.001% Pluronic F-68 + 200 mM NaCl
  • Serotype AAV5
  • Purification Iodixanol gradient ultracentrifugation
  • Reporter Gene HA


Requestor is responsible for compliance with their institution's biosafety regulations. Lentivirus is generally considered BSL-2. AAV is generally considered BSL-1, but may require BSL-2 handling depending on the insert. Biosafety Guide

Resource Information

Viral Quality Control

Quality Control:
  • Addgene ensures high quality viral vectors by optimizing and standardizing production protocols and performing rigorous quality control (QC) (see a list of our QC assays). The specific QC assays performed varies for each viral lot. To learn which specific QC assays were performed on your lot, please contact us.
  • Titer: the exact titer of your sample will be reported on the tube. The titer you see listed on this page is the guaranteed minimum titer. See how titers are measured.

Visit our viral production page for more information.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pOTTC1596 - pAAV SYN1 HA-hM3D(Gq) was a gift from Christopher Richie (Addgene plasmid # 121539 ; ; RRID:Addgene_121539)

    For viral preps, please replace (Addgene plasmid # 121539) in the above sentence with: (Addgene viral prep # 121539-AAV5)

  • For your References section:

    Ultrastructural localization of DREADDs in monkeys. Galvan A, Raper J, Hu X, Pare JF, Bonaventura J, Richie CT, Michaelides M, Mueller SAL, Roseboom PH, Oler JA, Kalin NH, Hall RA, Smith Y. Eur J Neurosci. 2019 May 7. doi: 10.1111/ejn.14429. 10.1111/ejn.14429 PubMed 31063250