pAAV-Ef1a-DIO hChR2(C128S/D156A)-EYFP
(Plasmid #35503)

• Purpose: AAV expression of Ef1a-driven, cre-dependent, stabilized step function opsin (SSFO) for optogenetic activation.
• Depositing Lab: Karl Deisseroth
• Publication: Yizhar et al Nature. 2011 Jul 27;477(7363):171-8. doi: 10.1038/nature10360.

Ordering

Item	Catalog #	Description	Quantity	Price (USD)
Plasmid	35503	Standard format: Plasmid sent in bacteria as agar stab	1	$75	Add to Cart
AAV1	35503-AAV1	Limited Stock Available, 1 unit left Virus (100 µL at titer ≥ 1×10¹³ vg/mL) and Plasmid. More Information	1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30	$380	Add to Cart

This material is available to academics and nonprofits only.

Backbone

• Vector backbone: pAAV
  (Search Vector Database)
• Backbone manufacturer: Stratagene
• Backbone size w/o insert (bp): 5605
• Modifications to backbone: Addition of an Ef1a promoter, lox sites and WPRE
• Vector type: Mammalian Expression, AAV

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin
• Growth Temperature: 37°C
• Growth Strain(s): NEB Stable
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: hChR2(C128S/D156A)-EYFP
• Alt name: SSFO-EYFP
• Species: Chlamydomonas reinhardtii
• Insert Size (bp): 1661
• Mutation: C128S and D156A
• Promoter: Ef1a
• Tag / Fusion Protein:
  • EYFP (C terminal on insert)

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: AscI (not destroyed)
• 3′ cloning site: NheI (not destroyed)
• 5′ sequencing primer: CACCCACACAAAGGAAAAGGGCC
• 3′ sequencing primer: GCAATAGCATGATACAAAGG

Resource Information

• Terms and Licenses:
  • UBMTA
  • Ancillary Agreement for Plasmids Containing FP Materials
  • genOway Notice of RIghts
• Industry Terms:
  • Not Available to Industry
• Articles Citing this Plasmid:
  • 2 References

Depositor Comments

ChR2 variant harboring two amino acid substitutions which act to stabilize the conducting state of the channel to deactivate with a time constant of nearly 30 minutes following a brief pulse of activating blue light. Like previously published step function opsins, this stabilized step function opsin (SSFO) may be deactivated using yellow light (590nm). The stabilized open state of the channel allows for both lower power activation, meaning in some circumstances the light delivery system need not penetrate the brain, as well as for behavior in the absence of a tethered laser or other light delivery system.

Information for AAV1 (Catalog # 35503-AAV1)

Purpose

Ready-to-use AAV1 particles produced from pAAV-Ef1a-DIO hChR2(C128S/D156A)-EYFP (#35503). In addition to the viral particles, you will also receive purified pAAV-Ef1a-DIO hChR2(C128S/D156A)-EYFP plasmid DNA.

EF1a-driven, cre-dependent, humanized channelrhodopsin C128S/D156A mutant fused to EYFP for optogenetic activation. These AAV preparations are suitable purity for injection into animals.

Delivery

• Volume: 100 µL
• Titer: ≥ 1×10¹³ vg/mL
• Pricing: $350 USD for preparation of 100 µL virus + $30 USD for plasmid.
• Storage: Store at -80℃. Thaw just before use and keep on ice.
• Shipment: Viral particles are shipped frozen on dry ice. Plasmid DNA (≥ 200ng) will also be included in the shipment.

Viral Production & Use

• Packaging Plasmids: encode adenoviral helper sequences and AAV rep gene, AAV1 cap gene
• Buffer: PBS + 0.001% Pluronic F-68
• Serotype: AAV1
• Purification: Iodixanol gradient ultracentrifugation
• Reporter Gene: EYFP (Cre-dependent)

Biosafety

Requestor is responsible for compliance with their institution's biosafety regulations. Lentivirus is generally considered BSL-2. AAV is generally considered BSL-1, but may require BSL-2 handling depending on the insert. Biosafety Guide

Resource Information

• Terms and Licenses:
  • Ancillary Agreement for Penn Vectors
  • Terms of Use for Viral Vectors
• Industry Terms:
  • Not Available to Industry

Viral Quality Control

Quality Control:

• Addgene ensures high quality viral vectors by optimizing and standardizing production protocols and performing rigorous quality control (QC) (see a list of our QC assays). The specific QC assays performed varies for each viral lot. To learn which specific QC assays were performed on your lot, please contact us.
• Titer: the exact titer of your sample will be reported on the tube. The titer you see listed on this page is the guaranteed minimum titer. See how titers are measured.

Visit our viral production page for more information.

Addgene Comments

Using FLEX vectors in vivo: LoxP sites in FLEX plasmids are known to recombine during DNA amplification and viral vector production, which may result in a minority of Cre-activated (i.e., "flipped") viral vectors. Addgene has measured this occurs in 0.01-0.03% of viral vectors in our typical production protocol. This can lead to a small number of cells exhibiting Cre-independent transgene expression in vivo. To address this, we recommend titrating to find the optimal AAV dosage required for Cre-dependent transgene expression and function in vivo. This may include reducing the viral vector dosage in order to reduce the likelihood of Cre-independent expression.