pAAV-Ef1a-DIO hChR2(C128S/D156A)-EYFP
(Plasmid #35503)

• Depositing Lab: Karl Deisseroth
• Publication: Yizhar et al Nature. 2011 Jul 27;477(7363):171-8. doi: 10.1038/nature10360.
• Price: $65 (USD)

Backbone

• Vector backbone: pAAV
  (Search Vector Database)
• Backbone manufacturer: Stratagene
• Backbone size w/o insert (bp): 5605
• Modifications to backbone: Addition of an Ef1a promoter, lox sites and WPRE
• Vector type: Mammalian Expression ; AAV

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin
• Growth Temperature: 37°C
• Growth Strain(s): Stbl3
• Copy number: High Copy

Sequence Information

• Depositor Sequences:
  Full (1)
• Addgene Sequences:
  Partial (2)

Gene/Insert

• Gene/Insert name: hChR2(C128S/D156A)-EYFP
• Alt name: SSFO-EYFP
• Species: Chlamydomonas reinhardtii
• Insert Size (bp): 1661
• Mutation: C128S and D156A
• Promoter: Ef1a
• Tag / Fusion Protein:
  • EYFP (C terminal on insert)

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: AscI (not destroyed)
• 3′ cloning site: NheI (not destroyed)
• 5′ sequencing primer: CACCCACACAAAGGAAAAGGGCC
• 3′ sequencing primer: GCAATAGCATGATACAAAGG

Resource Information

• Terms and Licenses:
  • UBMTA