-
PurposeAAV expression of Ef1a-driven, cre-dependent, stabilized step function opsin (SSFO) for optogenetic activation.
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | ||
---|---|---|---|---|---|---|
Plasmid | 35503 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $75 | ||
AAV1 | 35503-AAV1 | Viral service discontinued. |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonepAAV
-
Backbone manufacturerStratagene
- Backbone size w/o insert (bp) 5605
-
Modifications to backboneAddition of an Ef1a promoter, lox sites and WPRE
-
Vector typeMammalian Expression, AAV
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert namehChR2(C128S/D156A)-EYFP
-
Alt nameSSFO-EYFP
-
SpeciesChlamydomonas reinhardtii
-
Insert Size (bp)1661
-
MutationC128S and D156A
- Promoter Ef1a
-
Tag
/ Fusion Protein
- EYFP (C terminal on insert)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site AscI (not destroyed)
- 3′ cloning site NheI (not destroyed)
- 5′ sequencing primer CACCCACACAAAGGAAAAGGGCC
- 3′ sequencing primer GCAATAGCATGATACAAAGG (Common Sequencing Primers)
Resource Information
-
Terms and Licenses
-
Industry Terms
- Not Available to Industry
-
Articles Citing this Plasmid
Depositor Comments
ChR2 variant harboring two amino acid substitutions which act to stabilize the conducting state of the channel to deactivate with a time constant of nearly 30 minutes following a brief pulse of activating blue light. Like previously published step function opsins, this stabilized step function opsin (SSFO) may be deactivated using yellow light (590nm). The stabilized open state of the channel allows for both lower power activation, meaning in some circumstances the light delivery system need not penetrate the brain, as well as for behavior in the absence of a tethered laser or other light delivery system.
Information for AAV1 (Catalog # 35503-AAV1) ( Back to top )
Addgene no longer distributes this item. Contact [email protected] for more information.
Viral service discontinued.
Purpose
Ready-to-use AAV1 particles produced from pAAV-Ef1a-DIO hChR2(C128S/D156A)-EYFP (#35503). In addition to the viral particles, you will also receive purified pAAV-Ef1a-DIO hChR2(C128S/D156A)-EYFP plasmid DNA.
EF1a-driven, cre-dependent, humanized channelrhodopsin C128S/D156A mutant fused to EYFP for optogenetic activation. These AAV preparations are suitable purity for injection into animals.Delivery
- Volume .
- Titer ≥ 1×10¹³ vg/mL
- Pricing $350 USD for preparation of . virus + $30 USD for plasmid.
- Storage Store at -80℃. Thaw just before use and keep on ice.
- Shipment Viral particles are shipped frozen on dry ice. Plasmid DNA (≥ 200ng) will also be included in the shipment.
Viral Production & Use
- Packaging Plasmids encode adenoviral helper sequences and AAV rep gene, AAV1 cap gene
- Buffer PBS + 0.001% Pluronic F-68
- Serotype AAV1
- Purification Iodixanol gradient ultracentrifugation
- Reporter Gene EYFP (Cre-dependent)
Biosafety
Requestor is responsible for compliance with their institution's biosafety regulations. Lentivirus is generally considered BSL-2. AAV is generally considered BSL-1, but may require BSL-2 handling depending on the insert. Biosafety Guide
Resource Information
-
Terms and Licenses
-
Industry Terms
- Not Available to Industry
Viral Quality Control
- Addgene ensures high quality viral vectors by optimizing and standardizing production protocols and performing rigorous quality control (QC) (see a list of our QC assays). The specific QC assays performed varies for each viral lot. To learn which specific QC assays were performed on your lot, please contact us.
- Titer: the exact titer of your sample will be reported on the tube. The titer you see listed on this page is the guaranteed minimum titer. See how titers are measured.
Visit our viral production page for more information.
Addgene Comments
Using FLEX vectors in vivo: LoxP sites in FLEX plasmids are known to recombine during DNA amplification and viral vector production, which may result in a minority of Cre-activated (i.e., "flipped") viral vectors. Addgene has measured this occurs in 0.01-0.03% of viral vectors in our typical production protocol. This can lead to a small number of cells exhibiting Cre-independent transgene expression in vivo. To address this, we recommend titrating to find the optimal AAV dosage required for Cre-dependent transgene expression and function in vivo. This may include reducing the viral vector dosage in order to reduce the likelihood of Cre-independent expression.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pAAV-Ef1a-DIO hChR2(C128S/D156A)-EYFP was a gift from Karl Deisseroth (Addgene plasmid # 35503 ; http://n2t.net/addgene:35503 ; RRID:Addgene_35503)
For viral preps, please replace (Addgene plasmid # 35503) in the above sentence with: (Addgene viral prep # 35503-AAV1)
-
For your References section:
Neocortical excitation/inhibition balance in information processing and social dysfunction. Yizhar O, Fenno LE, Prigge M, Schneider F, Davidson TJ, O'Shea DJ, Sohal VS, Goshen I, Finkelstein J, Paz JT, Stehfest K, Fudim R, Ramakrishnan C, Huguenard JR, Hegemann P, Deisseroth K. Nature. 2011 Jul 27;477(7363):171-8. doi: 10.1038/nature10360. 10.1038/nature10360 PubMed 21796121