Plasmid 35504: pAAV-Ef1a-DIO hChR2(C128S/D156A)-mCherry
  • hChR2(C128S/D156A)-mCherry

  • SSFO-mCherry

  • 1646

  • Chlamydomonas reinhardtii

  • mCherry

  • C terminal on insert

  • C128S and D156A

  • pAAV
    (Search Vector Database)

  • Mammalian Expression ; AAV

  • Addition of an EF1a promoter, Lox sites and WPRE

  • Ef1a

  • AscI

  • No

  • NheI

  • No

  • CACCCACACAAAGGAAAAGGGCC List of Sequencing Primers


  • Ampicillin

  • Stbl3

  • 37

  • High Copy

  • View sequences (4)
  • View map

  • Karl Deisseroth

    Clontech Limited Use Label License


Addgene has sequenced a portion of this plasmid for verification. Click here for the sequencing result.

Article: Neocortical excitation/inhibition balance in information processing and social dysfunction. Yizhar et al (Nature. 2011 Jul 27;477(7363):171-8. doi: 10.1038/nature10360. PubMed)

Please acknowledge the principal investigator and cite this article if you use this plasmid in a publication. Also, please include the text "Addgene plasmid 35504" in your Materials and Methods section.