pAAV-Ef1a-DIO hChR2(E123T/T159C)-EYFP
(Plasmid #35509)

Available to Academic and Nonprofits Only


  • Vector backbone
  • Backbone manufacturer
  • Backbone size w/o insert (bp) 5605
  • Modifications to backbone
    Addition of an Ef1a promoter, lox sites and WPRE
  • Vector type
    Mammalian Expression ; AAV

Growth in Bacteria

  • Bacterial Resistance(s)
  • Growth Temperature
  • Growth Strain(s)
  • Copy number
    High Copy

Sequence Information


  • Gene/Insert name
  • Species
    Chlamydomonas reinhardtii
  • Insert Size (bp)
  • Mutation
    E123T and T159C
  • Promoter Ef1a
  • Tag / Fusion Protein
    • EYFP (C terminal on insert)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site AscI (not destroyed)
  • 3′ cloning site NheI (not destroyed)
  • 5′ sequencing primer CACCCACACAAAGGAAAAGGGCC
  • 3′ sequencing primer GCAATAGCATGATACAAAGG
  • (Common Sequencing Primers)

Resource Information

  • Terms and Licenses

Depositor Comments

How to cite this plasmid

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pAAV-Ef1a-DIO hChR2(E123T/T159C)-EYFP was a gift from Karl Deisseroth (Addgene plasmid # 35509)
  • For your References section:

    Principles for applying optogenetic tools derived from direct comparative analysis of microbial opsins. Mattis J, Tye KM, Ferenczi EA, Ramakrishnan C, O'Shea DJ, Prakash R, Gunaydin LA, Hyun M, Fenno LE, Gradinaru V, Yizhar O, Deisseroth K. Nat Methods. 2011 Dec 18;9(2):159-72. doi: 10.1038/nmeth.1808. 10.1038/nmeth.1808 PubMed 22179551