1
Plasmid 35509: pAAV-Ef1a-DIO hChR2(E123T/T159C)-EYFP
  • hChR2

  • 1661

  • Chlamydomonas reinhardtii

  • EYFP

  • C terminal on insert

  • E123T and T159C

  • pAAV
    (Search Vector Database)

  • Stratagene

  • Mammalian Expression ; AAV

  • 5605

  • Addition of an Ef1a promoter, lox sites and WPRE

  • Ef1a

  • AscI

  • No

  • NheI

  • No

  • CACCCACACAAAGGAAAAGGGCC List of Sequencing Primers

  • GCAATAGCATGATACAAAGG

  • Ampicillin

  • Stbl3

  • 37

  • High Copy

  • View sequences (3)
  • View map

  • Karl Deisseroth

  • UBMTA

Comments: 

Addgene has sequenced a portion of this plasmid for verification. Full plasmid sequence is available only if provided by the depositing laboratory.

Article: Principles for applying optogenetic tools derived from direct comparative analysis of microbial opsins. Mattis et al (Nat Methods. 2011 Dec 18;9(2):159-72. doi: 10.1038/nmeth.1808. PubMed)

Please acknowledge the principal investigator and cite this article if you use this plasmid in a publication. Also, please include the text "Addgene plasmid 35509" in your Materials and Methods section.