1
Plasmid 12210: pCMV6M-Pak1 K299R
  • Pak1

  • 2000

  • H. sapiens (human)

  • PAK1 (PAKalpha)

  • Myc

  • N terminal on insert

  • Catalytically inactive Pak1: K299R

  • pCMV6
    (Search Vector Database)

  • Mammalian Expression

  • 4900

  • SalI

  • No

  • EcoRI

  • No

  • CTCGTTTAGTGAACCGTCAG List of Sequencing Primers

  • GGAACTTCCAAGGCCAGGA

  • Ampicillin

  • DH5alpha

  • 37

  • High Copy

  • View sequences (4)
  • Jonathan Chernoff

  • MTA

Comments: 

Please note that the reference sequence from the depositor does not have the K299R mutation. Addgene has sequenced this plasmid and verified this mutation.

There is also an additional mutation in this plasmid - L516I. The L516I mutation, or SNP, has been present from the very beginning (~1995). The crystal structure of Pak1 uses this clone, so it is present there too. The depositor does not think it affects function in any way.

Addgene has sequenced a portion of this plasmid for verification. Click here for the sequencing result.

Article: Human p21-activated kinase (Pak1) regulates actin organization in mammalian cells. Sells et al (Curr Biol. 1997 Mar 1. 7(3):202-10. PubMed)

Please acknowledge the principal investigator and cite this article if you use this plasmid in a publication. Also, please include the text "Addgene plasmid 12210" in your Materials and Methods section.