Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at help@addgene.org. Learn more

pCMV6M-Pak1 K299R
(Plasmid #12210)

Loading...
Add to Cart
Available to Academic and Nonprofits Only

Backbone

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Sequence Information

Full plasmid sequence is available only if provided by the depositing laboratory.

Gene/Insert

  • Gene/Insert name
    Pak1
  • Species
    H. sapiens (human)
  • Insert Size (bp)
    2000
  • Mutation
    Catalytically inactive Pak1: K299R
  • Entrez Gene
    PAK1 (a.k.a. PAKalpha)
  • Tag / Fusion Protein
    • Myc (N terminal on insert)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site SalI (not destroyed)
  • 3′ cloning site EcoRI (not destroyed)
  • 5′ sequencing primer CTCGTTTAGTGAACCGTCAG
  • 3′ sequencing primer GGAACTTCCAAGGCCAGGA
  • (Common Sequencing Primers)

Resource Information

  • Terms and Licenses

Depositor Comments

Please note that the reference sequence from the depositor does not have the K299R mutation. Addgene has sequenced this plasmid and verified this mutation.

There is also an additional mutation in this plasmid - L516I. The L516I mutation, or SNP, has been present from the very beginning (~1995). The crystal structure of Pak1 uses this clone, so it is present there too. The depositor does not think it affects function in any way.

How to cite this plasmid

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pCMV6M-Pak1 K299R was a gift from Jonathan Chernoff (Addgene plasmid # 12210)
  • For your References section:

    Human p21-activated kinase (Pak1) regulates actin organization in mammalian cells. Sells MA, Knaus UG, Bagrodia S, Ambrose DM, Bokoch GM, Chernoff J. Curr Biol. 1997 Mar 1. 7(3):202-10. 10.1016/S0960-9822(97)70091-5 PubMed 9395435