Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected] Learn more

pCMV6M-Pak1 K299R
(Plasmid #12210)


Item Catalog # Description Quantity Price (USD)
Plasmid 12210 Standard format: Plasmid sent in bacteria as agar stab 1 $75

This material is available to academics and nonprofits only.


Growth in Bacteria

  • Bacterial Resistance(s)
  • Growth Temperature
  • Growth Strain(s)
  • Copy number
    High Copy


  • Gene/Insert name
  • Species
    H. sapiens (human)
  • Insert Size (bp)
  • Mutation
    Catalytically inactive Pak1: K299R
  • Entrez Gene
    PAK1 (a.k.a. IDDMSSD, PAKalpha, alpha-PAK, p65-PAK)
  • Tag / Fusion Protein
    • Myc (N terminal on insert)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site SalI (not destroyed)
  • 3′ cloning site EcoRI (not destroyed)
  • 5′ sequencing primer CTCGTTTAGTGAACCGTCAG
  • 3′ sequencing primer GGAACTTCCAAGGCCAGGA
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Depositor Comments

Please note that the reference sequence from the depositor does not have the K299R mutation. Addgene has sequenced this plasmid and verified this mutation.

There is also an additional mutation in this plasmid - L516I. The L516I mutation, or SNP, has been present from the very beginning (~1995). The crystal structure of Pak1 uses this clone, so it is present there too. The depositor does not think it affects function in any way.

Pak1 may contain a G401S mutation. Depositor states that this mutation should not affect plasmid function.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pCMV6M-Pak1 K299R was a gift from Jonathan Chernoff (Addgene plasmid # 12210 ; ; RRID:Addgene_12210)
  • For your References section:

    Human p21-activated kinase (Pak1) regulates actin organization in mammalian cells. Sells MA, Knaus UG, Bagrodia S, Ambrose DM, Bokoch GM, Chernoff J. Curr Biol. 1997 Mar 1. 7(3):202-10. 10.1016/S0960-9822(97)70091-5 PubMed 9395435